ID: 1053695911

View in Genome Browser
Species Human (GRCh38)
Location 9:40639177-40639199
Sequence TGACACAGGAAGGGAGGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695911_1053695919 17 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695911_1053695917 4 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695911_1053695922 23 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695922 9:40639223-40639245 GAGGTCATCAGTGCAGGCCATGG No data
1053695911_1053695923 24 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695923 9:40639224-40639246 AGGTCATCAGTGCAGGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695911 Original CRISPR TGACACAGGAAGGGAGGACT AGG (reversed) Intergenic