ID: 1053695912

View in Genome Browser
Species Human (GRCh38)
Location 9:40639183-40639205
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695912_1053695925 30 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695925 9:40639236-40639258 CAGGCCATGGGAGAGAAGGCAGG No data
1053695912_1053695919 11 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695912_1053695923 18 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695923 9:40639224-40639246 AGGTCATCAGTGCAGGCCATGGG No data
1053695912_1053695922 17 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695922 9:40639223-40639245 GAGGTCATCAGTGCAGGCCATGG 0: 6
1: 10
2: 13
3: 81
4: 356
1053695912_1053695924 26 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695924 9:40639232-40639254 AGTGCAGGCCATGGGAGAGAAGG No data
1053695912_1053695917 -2 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695912 Original CRISPR AGCAGTTGACACAGGAAGGG AGG (reversed) Intergenic