ID: 1053695913

View in Genome Browser
Species Human (GRCh38)
Location 9:40639186-40639208
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695913_1053695923 15 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695923 9:40639224-40639246 AGGTCATCAGTGCAGGCCATGGG No data
1053695913_1053695917 -5 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695913_1053695925 27 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695925 9:40639236-40639258 CAGGCCATGGGAGAGAAGGCAGG No data
1053695913_1053695919 8 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695913_1053695922 14 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695922 9:40639223-40639245 GAGGTCATCAGTGCAGGCCATGG No data
1053695913_1053695926 28 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695926 9:40639237-40639259 AGGCCATGGGAGAGAAGGCAGGG No data
1053695913_1053695924 23 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695924 9:40639232-40639254 AGTGCAGGCCATGGGAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695913 Original CRISPR TTGAGCAGTTGACACAGGAA GGG (reversed) Intergenic