ID: 1053695915

View in Genome Browser
Species Human (GRCh38)
Location 9:40639189-40639211
Sequence TTCCTGTGTCAACTGCTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695908_1053695915 6 Left 1053695908 9:40639160-40639182 CCATCTGTGAACCAGGCCCTAGT No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data
1053695905_1053695915 24 Left 1053695905 9:40639142-40639164 CCTGCCTATTGTGGAGAACCATC No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data
1053695909_1053695915 -5 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data
1053695910_1053695915 -10 Left 1053695910 9:40639176-40639198 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data
1053695906_1053695915 20 Left 1053695906 9:40639146-40639168 CCTATTGTGGAGAACCATCTGTG No data
Right 1053695915 9:40639189-40639211 TTCCTGTGTCAACTGCTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695915 Original CRISPR TTCCTGTGTCAACTGCTCAA AGG Intergenic