ID: 1053695916

View in Genome Browser
Species Human (GRCh38)
Location 9:40639191-40639213
Sequence TGCCTTTGAGCAGTTGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695916_1053695917 -10 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695916_1053695919 3 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695916_1053695925 22 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695925 9:40639236-40639258 CAGGCCATGGGAGAGAAGGCAGG No data
1053695916_1053695922 9 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695922 9:40639223-40639245 GAGGTCATCAGTGCAGGCCATGG No data
1053695916_1053695928 26 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695928 9:40639240-40639262 CCATGGGAGAGAAGGCAGGGTGG No data
1053695916_1053695923 10 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695923 9:40639224-40639246 AGGTCATCAGTGCAGGCCATGGG No data
1053695916_1053695926 23 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695926 9:40639237-40639259 AGGCCATGGGAGAGAAGGCAGGG No data
1053695916_1053695924 18 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695924 9:40639232-40639254 AGTGCAGGCCATGGGAGAGAAGG No data
1053695916_1053695929 30 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695929 9:40639244-40639266 GGGAGAGAAGGCAGGGTGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695916 Original CRISPR TGCCTTTGAGCAGTTGACAC AGG (reversed) Intergenic