ID: 1053695917

View in Genome Browser
Species Human (GRCh38)
Location 9:40639204-40639226
Sequence CTCAAAGGCAAGTCCCCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695910_1053695917 5 Left 1053695910 9:40639176-40639198 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695916_1053695917 -10 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695914_1053695917 -6 Left 1053695914 9:40639187-40639209 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695909_1053695917 10 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695913_1053695917 -5 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695912_1053695917 -2 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695908_1053695917 21 Left 1053695908 9:40639160-40639182 CCATCTGTGAACCAGGCCCTAGT No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data
1053695911_1053695917 4 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695917 9:40639204-40639226 CTCAAAGGCAAGTCCCCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695917 Original CRISPR CTCAAAGGCAAGTCCCCATG AGG Intergenic