ID: 1053695919

View in Genome Browser
Species Human (GRCh38)
Location 9:40639217-40639239
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695913_1053695919 8 Left 1053695913 9:40639186-40639208 CCCTTCCTGTGTCAACTGCTCAA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695916_1053695919 3 Left 1053695916 9:40639191-40639213 CCTGTGTCAACTGCTCAAAGGCA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695910_1053695919 18 Left 1053695910 9:40639176-40639198 CCCTAGTCCTCCCTTCCTGTGTC No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695909_1053695919 23 Left 1053695909 9:40639171-40639193 CCAGGCCCTAGTCCTCCCTTCCT No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695911_1053695919 17 Left 1053695911 9:40639177-40639199 CCTAGTCCTCCCTTCCTGTGTCA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695914_1053695919 7 Left 1053695914 9:40639187-40639209 CCTTCCTGTGTCAACTGCTCAAA No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data
1053695912_1053695919 11 Left 1053695912 9:40639183-40639205 CCTCCCTTCCTGTGTCAACTGCT No data
Right 1053695919 9:40639217-40639239 CCCCATGAGGTCATCAGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695919 Original CRISPR CCCCATGAGGTCATCAGTGC AGG Intergenic