ID: 1053695960

View in Genome Browser
Species Human (GRCh38)
Location 9:40639533-40639555
Sequence AGTTAACTGGAGAAGATGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053695956_1053695960 15 Left 1053695956 9:40639495-40639517 CCCAGTATAGGACAAGAGCTGTC No data
Right 1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG No data
1053695955_1053695960 24 Left 1053695955 9:40639486-40639508 CCACAAAAGCCCAGTATAGGACA No data
Right 1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG No data
1053695957_1053695960 14 Left 1053695957 9:40639496-40639518 CCAGTATAGGACAAGAGCTGTCT No data
Right 1053695960 9:40639533-40639555 AGTTAACTGGAGAAGATGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053695960 Original CRISPR AGTTAACTGGAGAAGATGAC CGG Intergenic
No off target data available for this crispr