ID: 1053698166

View in Genome Browser
Species Human (GRCh38)
Location 9:40658476-40658498
Sequence GCCTTGTAATACGCCCGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053698163_1053698166 -1 Left 1053698163 9:40658454-40658476 CCAGGATGGTCTCGATCTCCTGG 0: 389
1: 53730
2: 75466
3: 152867
4: 231362
Right 1053698166 9:40658476-40658498 GCCTTGTAATACGCCCGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053698166 Original CRISPR GCCTTGTAATACGCCCGCCT TGG Intergenic
No off target data available for this crispr