ID: 1053705641

View in Genome Browser
Species Human (GRCh38)
Location 9:40750331-40750353
Sequence ACCTAGGAGAAACTCCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053705641_1053705644 -3 Left 1053705641 9:40750331-40750353 CCTGAAGGGAGTTTCTCCTAGGT No data
Right 1053705644 9:40750351-40750373 GGTCTGGTCAGACTTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053705641 Original CRISPR ACCTAGGAGAAACTCCCTTC AGG (reversed) Intergenic
No off target data available for this crispr