ID: 1053705731

View in Genome Browser
Species Human (GRCh38)
Location 9:40751133-40751155
Sequence CTCAACCATCTGCAGTTCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053705731_1053705735 29 Left 1053705731 9:40751133-40751155 CCCTCGAACTGCAGATGGTTGAG No data
Right 1053705735 9:40751185-40751207 CTATATCTTCACCAGCGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053705731 Original CRISPR CTCAACCATCTGCAGTTCGA GGG (reversed) Intergenic
No off target data available for this crispr