ID: 1053711744

View in Genome Browser
Species Human (GRCh38)
Location 9:40818652-40818674
Sequence CACAAAGAAGTTTCTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053711744_1053711745 26 Left 1053711744 9:40818652-40818674 CCATTTTCAGAAACTTCTTTGTG No data
Right 1053711745 9:40818701-40818723 AACCTTTCTTTTGATAGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053711744 Original CRISPR CACAAAGAAGTTTCTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr