ID: 1053725163

View in Genome Browser
Species Human (GRCh38)
Location 9:40992036-40992058
Sequence CTAGAGCTGCGGGCTGGCGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053725163_1053725170 4 Left 1053725163 9:40992036-40992058 CCGTCGCCAGCCCGCAGCTCTAG No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725163_1053725174 28 Left 1053725163 9:40992036-40992058 CCGTCGCCAGCCCGCAGCTCTAG No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053725163 Original CRISPR CTAGAGCTGCGGGCTGGCGA CGG (reversed) Intergenic