ID: 1053725170

View in Genome Browser
Species Human (GRCh38)
Location 9:40992063-40992085
Sequence AGGCAGTTCCACAGCGTGCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053725166_1053725170 -2 Left 1053725166 9:40992042-40992064 CCAGCCCGCAGCTCTAGCGGGAG No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725168_1053725170 -6 Left 1053725168 9:40992046-40992068 CCCGCAGCTCTAGCGGGAGGCAG No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725169_1053725170 -7 Left 1053725169 9:40992047-40992069 CCGCAGCTCTAGCGGGAGGCAGT No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725162_1053725170 12 Left 1053725162 9:40992028-40992050 CCACGGGACCGTCGCCAGCCCGC No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725160_1053725170 14 Left 1053725160 9:40992026-40992048 CCCCACGGGACCGTCGCCAGCCC No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725156_1053725170 25 Left 1053725156 9:40992015-40992037 CCGCTTCCCGCCCCCACGGGACC No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725157_1053725170 19 Left 1053725157 9:40992021-40992043 CCCGCCCCCACGGGACCGTCGCC No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725161_1053725170 13 Left 1053725161 9:40992027-40992049 CCCACGGGACCGTCGCCAGCCCG No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725163_1053725170 4 Left 1053725163 9:40992036-40992058 CCGTCGCCAGCCCGCAGCTCTAG No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725158_1053725170 18 Left 1053725158 9:40992022-40992044 CCGCCCCCACGGGACCGTCGCCA No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data
1053725159_1053725170 15 Left 1053725159 9:40992025-40992047 CCCCCACGGGACCGTCGCCAGCC No data
Right 1053725170 9:40992063-40992085 AGGCAGTTCCACAGCGTGCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053725170 Original CRISPR AGGCAGTTCCACAGCGTGCC CGG Intergenic