ID: 1053725174

View in Genome Browser
Species Human (GRCh38)
Location 9:40992087-40992109
Sequence AGCCCCGCCACCGTCAGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053725168_1053725174 18 Left 1053725168 9:40992046-40992068 CCCGCAGCTCTAGCGGGAGGCAG No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data
1053725163_1053725174 28 Left 1053725163 9:40992036-40992058 CCGTCGCCAGCCCGCAGCTCTAG No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data
1053725169_1053725174 17 Left 1053725169 9:40992047-40992069 CCGCAGCTCTAGCGGGAGGCAGT No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data
1053725171_1053725174 -7 Left 1053725171 9:40992071-40992093 CCACAGCGTGCCCGGCAGCCCCG No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data
1053725166_1053725174 22 Left 1053725166 9:40992042-40992064 CCAGCCCGCAGCTCTAGCGGGAG No data
Right 1053725174 9:40992087-40992109 AGCCCCGCCACCGTCAGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053725174 Original CRISPR AGCCCCGCCACCGTCAGCAC CGG Intergenic