ID: 1053726425

View in Genome Browser
Species Human (GRCh38)
Location 9:41006475-41006497
Sequence GAAGCTCTTTTAGGCAGGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053726421_1053726425 -2 Left 1053726421 9:41006454-41006476 CCATGTTTAGTGCTTCCTTCAGA 0: 55
1: 4832
2: 4254
3: 2022
4: 1033
Right 1053726425 9:41006475-41006497 GAAGCTCTTTTAGGCAGGCCTGG No data
1053726420_1053726425 3 Left 1053726420 9:41006449-41006471 CCTTTCCATGTTTAGTGCTTCCT 0: 4523
1: 4061
2: 1998
3: 833
4: 631
Right 1053726425 9:41006475-41006497 GAAGCTCTTTTAGGCAGGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053726425 Original CRISPR GAAGCTCTTTTAGGCAGGCC TGG Intergenic
No off target data available for this crispr