ID: 1053727003

View in Genome Browser
Species Human (GRCh38)
Location 9:41014454-41014476
Sequence ATAGGGAAGAAAAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053727000_1053727003 -10 Left 1053727000 9:41014441-41014463 CCCACTTCTGCTTATAGGGAAGA No data
Right 1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053727003 Original CRISPR ATAGGGAAGAAAAATGAGGA AGG Intergenic
No off target data available for this crispr