ID: 1053729714

View in Genome Browser
Species Human (GRCh38)
Location 9:41041080-41041102
Sequence CTGCTCTGCTAGGAAATGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 223}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053729710_1053729714 14 Left 1053729710 9:41041043-41041065 CCAGTTCAATGAACATTATGGAG No data
Right 1053729714 9:41041080-41041102 CTGCTCTGCTAGGAAATGAAGGG 0: 2
1: 0
2: 0
3: 12
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053729714 Original CRISPR CTGCTCTGCTAGGAAATGAA GGG Intergenic
900237025 1:1597829-1597851 CTGTCCTGCTAGGAACTGCAAGG + Intergenic
901084153 1:6600661-6600683 CTGCTCTGCTGGGACATTTATGG + Intronic
901474714 1:9481517-9481539 GTGCTCTGCAAGGTAATGGACGG + Intergenic
902786253 1:18734464-18734486 CTGCTCTGCTCTGAACTGACTGG + Intronic
903225313 1:21891176-21891198 GTGCTCTGCTAGGGAAAGCAGGG - Intronic
909274726 1:73668403-73668425 CTGCTTTGCTTGGCTATGAAAGG + Intergenic
910574815 1:88749199-88749221 CTTCTCTACTAGGAGATGATAGG + Intronic
913239714 1:116819491-116819513 CTGCCCTAACAGGAAATGAAGGG - Intergenic
915276400 1:154791756-154791778 CTCCTCTGCTGCCAAATGAATGG + Intronic
917637292 1:176949479-176949501 CTGCTGTGGTAGGAAATTCATGG - Intronic
918189885 1:182163936-182163958 CTCCCCAGCTGGGAAATGAAGGG - Intergenic
923124244 1:231021574-231021596 CTTTTCTGTTAGGAAACGAAAGG + Intronic
923139344 1:231147890-231147912 CTGCCCTAACAGGAAATGAAAGG - Intergenic
923731202 1:236552006-236552028 CAACTCTGCTAAGAAAGGAATGG + Exonic
1065828702 10:29595371-29595393 CGGCTCTGCTAGGGTATGGATGG + Intronic
1066445814 10:35481800-35481822 CTGCTCAACTAGGATATAAAAGG - Intronic
1067389865 10:45853860-45853882 CTGAACTGATAGGAAGTGAAAGG - Intronic
1067501605 10:46809989-46810011 CTGAACTGATAGGAAGTGAAAGG + Intergenic
1067592969 10:47529920-47529942 CTGAACTGATAGGAAGTGAAAGG - Intronic
1067873400 10:49982185-49982207 CTGAACTGATAGGAAGTGAAAGG + Intronic
1068752964 10:60617570-60617592 ATGCTGTGCTAGGCACTGAAGGG - Intronic
1068815708 10:61309257-61309279 CTGCACTTCTAGCAAATGTAAGG + Intergenic
1068885102 10:62089898-62089920 CTGCTCTGCTAAGACATGTCAGG + Intronic
1068918536 10:62459723-62459745 CAGCTCTGAAAGGAAAAGAAGGG - Exonic
1069126129 10:64636642-64636664 CTGCTGTGCTAGGGAATGGTTGG + Intergenic
1069630515 10:69894592-69894614 CTTCTCTGCTGGGAAATAGATGG - Intronic
1070137049 10:73704062-73704084 CTGAACTGATAGGAAGTGAAAGG - Intergenic
1071191485 10:83106842-83106864 TTGCTCTTCTCGGAAAAGAATGG + Intergenic
1072491150 10:95907461-95907483 CTGCCTTGCTAGGAAAAGAGGGG - Intronic
1074477400 10:113785225-113785247 CTGCACGGCTAAGAAAAGAAAGG + Intergenic
1074557804 10:114508005-114508027 CTGCTCTGCAAAGAAATGCTGGG + Intronic
1074935868 10:118180882-118180904 CTGATCTGCTAGAAGATCAAAGG + Intergenic
1076931907 10:133537045-133537067 CTTCTCTGCCAAGATATGAATGG - Exonic
1077106422 11:844410-844432 GGGCTCTGCTGGGAAATGGAGGG - Intronic
1078439715 11:11354282-11354304 TTGCTCACCTGGGAAATGAAGGG - Intronic
1079490388 11:20982624-20982646 CTCCTCTTCTACAAAATGAAGGG - Intronic
1081311292 11:41576828-41576850 GTGCACTGCTAGGAATTTAATGG - Intergenic
1081896884 11:46594394-46594416 CTGCTCTGTTAGGAAACTAAGGG - Intergenic
1082061230 11:47861923-47861945 CTGCTGTGCTGGGACAAGAATGG - Intergenic
1082754352 11:57058495-57058517 TTACTCTAATAGGAAATGAAGGG - Intergenic
1086163405 11:83748836-83748858 CTGCTTTTCTGGGAAATGGAGGG - Intronic
1087484196 11:98741195-98741217 TTACACTGCTAAGAAATGAATGG + Intergenic
1088114752 11:106301620-106301642 CTGTTCTGCCAGGAAATTTAAGG + Intergenic
1089603572 11:119629002-119629024 CTGCTGGGCTTGGCAATGAAAGG - Intronic
1090084765 11:123641236-123641258 CTCCTCTGGTGTGAAATGAAGGG - Intronic
1092289472 12:7150636-7150658 CTTTCCTGCTCGGAAATGAATGG + Exonic
1093336750 12:17914158-17914180 CTGCCCTAACAGGAAATGAAAGG + Intergenic
1093441042 12:19196597-19196619 TTTCTCTGCTAGGAAATGGCAGG - Intronic
1093841769 12:23911614-23911636 CTGCTCTGCAAGGAACTGTAAGG - Intronic
1094281356 12:28743185-28743207 CTGCTCCAGAAGGAAATGAAGGG + Intergenic
1096739128 12:53678841-53678863 ATGGTCTGGTAGGAAAAGAAAGG - Intergenic
1096787602 12:54026502-54026524 CTTCTCCCCAAGGAAATGAAGGG - Intronic
1097794008 12:63843789-63843811 CTGCTCCGCTAGGAAACGCCTGG - Intergenic
1098601269 12:72334460-72334482 CTGCCCTAATAAGAAATGAAGGG + Intronic
1101150563 12:101878820-101878842 CTGCTATGATAGAAAATGTAGGG + Intronic
1107585490 13:41842918-41842940 CTGCTCTTCTAGGGCATCAATGG + Intronic
1108827546 13:54432919-54432941 CTGCCCTAATGGGAAATGAAGGG - Intergenic
1111897800 13:94162570-94162592 CTGCTCTGCCTGGAAATCCAGGG + Intronic
1114926556 14:27407948-27407970 CTTCTATGCTGGGAACTGAATGG + Intergenic
1116573213 14:46544732-46544754 TTTCTCTACTAGAAAATGAAAGG - Intergenic
1118071071 14:62247099-62247121 CTGCTCTGCAAGCAAAGAAAAGG + Intergenic
1119488528 14:75009380-75009402 CTGCTCTGTTAAGATCTGAAAGG - Exonic
1120207886 14:81605917-81605939 CTGCACTGATAGGAAAGGAATGG + Intergenic
1121916331 14:97839606-97839628 CTTCTCATCTAGGAAAAGAAAGG + Intergenic
1122863632 14:104593739-104593761 CTGCTCTGCAGGGAAAGGACAGG + Intronic
1123886848 15:24734996-24735018 CTGCCCTTATAGGAAATAAAGGG - Intergenic
1123898231 15:24849633-24849655 CTCCAATACTAGGAAATGAAGGG - Intronic
1126861670 15:52890268-52890290 TTGCTCATCTAGGAAATGAGAGG + Intergenic
1127471315 15:59293131-59293153 TTATTCTGCTAGGAAAAGAAGGG + Intronic
1129697218 15:77747482-77747504 CTGCTCTTCTAGGCAGTGAGAGG - Intronic
1129912670 15:79241330-79241352 CTGATCTGCTTGGGATTGAAGGG - Intergenic
1136126084 16:28181853-28181875 CTGCTCAGGTTGGAAATGAGAGG + Intronic
1137795153 16:51211047-51211069 CTGCTCTGGTAGGGGATAAAAGG + Intergenic
1140711227 16:77679182-77679204 CAGCTCTCCTAGGAGGTGAAAGG + Intergenic
1142645125 17:1306641-1306663 CGGTTCTGTTAGGAAAAGAATGG + Intergenic
1144007959 17:11118437-11118459 CTGCCCTATGAGGAAATGAAGGG + Intergenic
1148934350 17:51152850-51152872 CTGCTCTAAGGGGAAATGAACGG - Intergenic
1149037701 17:52154550-52154572 CTGCTTTGGTAGGAAGGGAATGG + Intronic
1149066669 17:52488938-52488960 CTGCTCTAATGGGAAATGATAGG + Intergenic
1149071231 17:52545781-52545803 CTGCTCTGCTTTTAAATGACAGG + Intergenic
1150741930 17:67786059-67786081 CTGCCCTAATGGGAAATGAAGGG - Intergenic
1150813987 17:68378384-68378406 CGGCTCGGCCAGGAAAGGAAAGG - Intronic
1153521630 18:5959574-5959596 CTGCTCTGGAAGCAAATGCAGGG + Intronic
1154033670 18:10777255-10777277 CTGCTCCGTTAGAACATGAAAGG - Intronic
1154970238 18:21400924-21400946 CTGCTCTAAAAGGAAAGGAAAGG - Intronic
1155089266 18:22490300-22490322 CTCCTTTGCTATGAAATGACAGG + Intergenic
1155205607 18:23555400-23555422 CTTCTCTGTTAGGAAATAAGGGG - Intronic
1155784125 18:29876408-29876430 CTGGTGTGCTAGGAAATCTAGGG - Intergenic
1157797824 18:50591696-50591718 CTCCTCTGTTAGGCAAAGAATGG - Intronic
1158094443 18:53754873-53754895 CTGCTCTTCAAGCAAATGAGAGG - Intergenic
1158297962 18:56020143-56020165 CTGCTCTTTCAGGAAATGGAGGG - Intergenic
1158709859 18:59827897-59827919 CTGCTCAGCTAGGAAACTTACGG - Intergenic
1158865886 18:61637189-61637211 CTGCTCCTCTAGAAAATGCATGG - Intergenic
1159672551 18:71239540-71239562 CTGACCCACTAGGAAATGAAGGG - Intergenic
1159994542 18:74951072-74951094 CTGCCCTGCTACCACATGAAGGG - Intronic
1161010672 19:1958154-1958176 CTGCTCTGCCTGGAATTGAGGGG + Intronic
1161533540 19:4804511-4804533 CTGCTCAACGAGGGAATGAACGG + Intergenic
1164257041 19:23536770-23536792 CTACTCTGATAGGAAATGGGAGG + Intronic
1167472711 19:49684504-49684526 CTGCTCTGAGAGGAAAAGCACGG - Intronic
925048031 2:789419-789441 ATGCTATGCTATGAATTGAATGG - Intergenic
926416335 2:12653162-12653184 CTGCTCTGCCATAAAATCAACGG - Intergenic
927291233 2:21406876-21406898 TTGTTCTGCTGGGAAATGATAGG - Intergenic
930972630 2:57415507-57415529 ATGCTCTGCTTGGAAATTATTGG - Intergenic
931522996 2:63119790-63119812 CTCCTCTGCTAGAACCTGAAAGG - Intergenic
932027134 2:68145740-68145762 CTGCACTACTGGGCAATGAATGG + Intronic
932426488 2:71639610-71639632 CTGAACTGCTTGGAACTGAACGG - Intronic
934133258 2:88969878-88969900 CTGTTCTGCTTGGAAAGAAAAGG + Intergenic
934157714 2:89218675-89218697 CTGTTCTGCTTAGAAATAAAAGG + Intergenic
934209551 2:89963751-89963773 CTGTTCTGCTTAGAAATAAAAGG - Intergenic
934220305 2:90076234-90076256 CTGTTCTGCTTGGAAATAAAAGG - Intergenic
935504065 2:103877336-103877358 TTTATTTGCTAGGAAATGAATGG + Intergenic
936254090 2:110894598-110894620 CTGCCCTGCTAGGAAGTAACAGG + Intronic
937461834 2:122095893-122095915 CTGAACTGCTAGAAAATGACTGG + Intergenic
938202323 2:129383848-129383870 CACCTCTTCTAGAAAATGAAAGG - Intergenic
938254972 2:129850564-129850586 CTGCTGTGCTAGGGAATGGAAGG - Intergenic
939738108 2:145874837-145874859 TTGCTCTCCTAGGAAGTAAAAGG + Intergenic
940462400 2:153982024-153982046 CCCCTCTGCTAGAAACTGAAAGG + Intronic
940534271 2:154919010-154919032 ATCCTCTGTTAGGAAAGGAAAGG - Intergenic
940986513 2:160057118-160057140 CCCCTCTCCTAGGAAATTAAGGG + Intronic
942061348 2:172231241-172231263 CTGCTCTGACAGGAAAGGACAGG + Intergenic
943995816 2:194764272-194764294 CAGCTTTGATATGAAATGAAAGG + Intergenic
946889010 2:224255043-224255065 CGGCGCTGTTATGAAATGAATGG - Intergenic
947366557 2:229402583-229402605 CTGCTCTGGTGAGAAAGGAATGG + Intronic
1169498216 20:6134624-6134646 CAGCCCTGCCAGGAAATGGAGGG + Intergenic
1169733224 20:8809543-8809565 CGGCTCTCCTGGAAAATGAAAGG - Intronic
1170032537 20:11958039-11958061 CTGCTCAGCTGGGAAATGGCTGG + Intergenic
1172885078 20:38225558-38225580 CTGCTATGCTAAAAAATAAACGG - Intronic
1173309690 20:41886450-41886472 CTGCTCTGCTTATAATTGAATGG - Intergenic
1173877249 20:46381710-46381732 CAGCTTTGCGAGGAGATGAAAGG - Intronic
1174093916 20:48072294-48072316 CTGATCTGCTTGCCAATGAAGGG + Intergenic
1174794923 20:53514013-53514035 CTGCTGTGCTGGGGAATGCAGGG + Intergenic
1175009748 20:55723291-55723313 CTGTTATGCTTGGAAATGATAGG - Intergenic
1178041055 21:28641491-28641513 CTGTTCTGTTAGGAAATGGGTGG - Intergenic
1178673295 21:34611060-34611082 ATTCACTGCTTGGAAATGAACGG + Intronic
1178883248 21:36465024-36465046 CTGCTTTGCTAGGGACTGAGGGG + Intronic
1183186840 22:36296697-36296719 CTGTTTTGCTATGAAATAAATGG + Intronic
951120133 3:18916969-18916991 TTGCTATGCTAGGAAATGCCAGG - Intergenic
953202083 3:40786829-40786851 ATGCCCTGTTAGGAACTGAAGGG - Intergenic
953288207 3:41634070-41634092 CTGCCCTAACAGGAAATGAAAGG + Intronic
960438775 3:117661088-117661110 GGGCCCTGCAAGGAAATGAAAGG - Intergenic
960968086 3:123119485-123119507 ATGCTTTTCTAGGAAATGAAAGG - Intronic
961641018 3:128364887-128364909 CTACACTGCTAGTAAGTGAATGG + Intronic
963857103 3:150266169-150266191 ATGTTCTGCTTGGAAATGACGGG + Intergenic
964308507 3:155366326-155366348 ATACTCTTATAGGAAATGAAGGG + Intergenic
965432271 3:168604390-168604412 CTGCTTAGCTTAGAAATGAATGG - Intergenic
965878262 3:173354751-173354773 CTACCCTAGTAGGAAATGAAGGG - Intergenic
965899575 3:173622009-173622031 CTGCTTTGGTAAAAAATGAAAGG - Intronic
967080464 3:186044912-186044934 CTGCACCGCTGGGCAATGAACGG + Intergenic
967771812 3:193342026-193342048 CTGCTCGGCTAGCAAGTGAAAGG - Intronic
967903089 3:194477211-194477233 GTCCTCTGCTAGGAGATGGAAGG - Intronic
969952996 4:10858427-10858449 CAGCTTTGCTAGGAAATTACTGG + Intergenic
970233841 4:13938714-13938736 CAACTCTGATGGGAAATGAAGGG + Intergenic
972740126 4:41880581-41880603 CTGCTCCGCTTGGAGATCAAAGG - Intergenic
975759477 4:77604835-77604857 CTGATCTGCTAAGAAATCAGAGG - Intronic
977822280 4:101487580-101487602 CTGATATGCTAATAAATGAAAGG - Intronic
978392369 4:108240707-108240729 GTGCTCTTCTAGGATAGGAAGGG + Intergenic
979887533 4:126048078-126048100 CTGCTCAGCCATGAAAGGAATGG + Intergenic
980652120 4:135731426-135731448 CTGCTCTGGAAGTAAATGTATGG - Intergenic
982092430 4:151892175-151892197 CTGCTCAGCTAGGGAAAGCAGGG + Intergenic
985771428 5:1814355-1814377 CTGCTCTGCTATCAAATCAATGG - Exonic
986737774 5:10680944-10680966 CTACTCTGCTGGGAAATCTAAGG - Exonic
987663937 5:20911421-20911443 CTGATCTGATAGGAGATCAAAGG - Intergenic
988758753 5:34290770-34290792 CTGATCTGATAGGAGATCAAAGG + Intergenic
990002508 5:50910709-50910731 CTGCCCTCCTAGGACAAGAAAGG - Intergenic
992377694 5:76204971-76204993 CTCCTCTGCTGGGAAATGTGAGG - Intronic
995665449 5:114536550-114536572 CTGCTTTGCTTGGCTATGAAAGG + Intergenic
997073863 5:130648505-130648527 CTGCTCAGCAAAGAATTGAAGGG + Intergenic
997691206 5:135828687-135828709 CTGCTCTGCGAGTGGATGAAAGG - Intergenic
999591943 5:153157833-153157855 CCTCTCTGAAAGGAAATGAAGGG + Intergenic
1000295155 5:159906997-159907019 CTGCCCTTCTAGGGTATGAATGG + Intergenic
1001501213 5:172236296-172236318 CAGCTCTGCTACTAAATGGATGG - Intronic
1001946242 5:175780667-175780689 CTACTCTTCTAGGTAAAGAATGG - Intergenic
1003501039 6:6703018-6703040 CTGCTCATCTGGGAAAAGAAAGG - Intergenic
1003956895 6:11172657-11172679 GTGGTCTGATGGGAAATGAAAGG - Intergenic
1004050003 6:12067770-12067792 CTGCTCTGGTAGGGAAGGGAAGG + Intronic
1005355519 6:24979602-24979624 CTGCTTTGCTGGGGAAGGAAAGG + Intronic
1006389994 6:33752568-33752590 CTCCTCTCCTGGAAAATGAAAGG - Intergenic
1008386605 6:50898179-50898201 CTGCTGTTCTAGGAGCTGAAAGG + Intergenic
1008477872 6:51951966-51951988 CTTCTCTGCTAGGAAGGGACTGG + Intronic
1008731950 6:54493298-54493320 ATTGTCTGCTAGGAAATCAAAGG - Intergenic
1010613320 6:77983431-77983453 CTGGTTTCCTAGGTAATGAATGG - Intergenic
1017079971 6:150658668-150658690 CTCCTCTTTGAGGAAATGAAGGG + Intronic
1017965026 6:159256686-159256708 TTGCTTTGGTTGGAAATGAAGGG + Intronic
1020315770 7:6904448-6904470 TTTCTCTACTAGAAAATGAAAGG - Intergenic
1022443284 7:30451069-30451091 CTGCCCTGCTAAGAAAGAAAAGG + Intronic
1023779943 7:43646262-43646284 CAGCTATGATAGGAAAAGAAGGG + Intronic
1024829313 7:53430135-53430157 TTGCAGTGCTAGGAAACGAATGG - Intergenic
1024948029 7:54831591-54831613 CTACTCTGCTTGGGAATAAAAGG - Intergenic
1027662805 7:81007253-81007275 GTTCTCTGCTGGAAAATGAAGGG - Intergenic
1028343379 7:89750138-89750160 TTGCTCTTATGGGAAATGAAAGG + Intergenic
1028462625 7:91112923-91112945 CTGGTAAGCTAGCAAATGAATGG - Intronic
1028781635 7:94744086-94744108 CTGCTTTGATAGGAAGTTAATGG - Intergenic
1029897900 7:104005543-104005565 CTCCACTGCTAGGCAATGGAAGG - Intergenic
1030999958 7:116403533-116403555 CTGCACTGCTATTAAATGAAAGG + Intronic
1032100755 7:128974924-128974946 CTGCTGTTCTAGGAGCTGAAAGG + Exonic
1033384209 7:140855520-140855542 CTGCTATGGAAGGACATGAAGGG + Intronic
1033631849 7:143166107-143166129 CAGCTTTGCTAGGCTATGAAAGG + Intergenic
1034063720 7:148117164-148117186 CTGCTCTGTCAGGCAATGAGTGG + Intronic
1034987603 7:155526630-155526652 CTGCACTGGTAGTCAATGAAAGG + Intronic
1035372221 7:158386843-158386865 CTGCTACCCTAGGAGATGAATGG + Intronic
1036289433 8:7474303-7474325 CTGCTCAGCTTGTAAAAGAAGGG + Intronic
1036332044 8:7837229-7837251 CTGCTCAGCTTGTAAAAGAAGGG - Intronic
1036960716 8:13241843-13241865 CTGCTAAGAGAGGAAATGAAAGG - Intronic
1037602363 8:20408047-20408069 CTGCTTTGCTATAAAATGAATGG + Intergenic
1040651552 8:49455000-49455022 CTGCTCTGGAAGTAATTGAAAGG - Intergenic
1041617373 8:59923282-59923304 CTGATCTGGAAGGAAAAGAAGGG + Intergenic
1041754473 8:61298963-61298985 CTGCTTTCCTAGTAAAAGAATGG + Intronic
1044828959 8:96226422-96226444 TTCCTCAGCTAGAAAATGAAGGG - Intronic
1046076149 8:109314464-109314486 CTCCACTGCTAGAAAATGACAGG + Intronic
1048566987 8:135611424-135611446 CTGCTCTGCTATAAATTGAAAGG + Intronic
1050338707 9:4614549-4614571 GTGTTCTGCAAGGATATGAAGGG + Intronic
1053729714 9:41041080-41041102 CTGCTCTGCTAGGAAATGAAGGG + Intergenic
1054698791 9:68390982-68391004 CTGCTCTGCTAGGAAATGAAGGG - Intronic
1054945810 9:70794818-70794840 CTGCCCTTCTAGGATGTGAATGG - Intronic
1057394040 9:94663676-94663698 CTGCTTTCCTAGGGAATGTAGGG - Intergenic
1059400225 9:114064913-114064935 CTCCTCTGTCAGGAAAGGAAAGG - Intronic
1059516826 9:114903540-114903562 CTGCCCTAATGGGAAATGAAGGG - Exonic
1060910720 9:127347905-127347927 CTGCTCTCTTAGAAAAGGAAAGG - Intronic
1060936997 9:127521746-127521768 CTGCTGGGCCAGGGAATGAAGGG - Intronic
1061927263 9:133812061-133812083 CTGCTCTGCGAGGGAAGGGAGGG + Intronic
1061933562 9:133845563-133845585 CTTGTCTGCTGGGAAATGAAGGG + Intronic
1062709624 9:137967567-137967589 CTGCTCTCCCCTGAAATGAATGG + Intronic
1185804043 X:3040605-3040627 CTCCTCAGCTTGGAAAAGAAAGG + Intergenic
1188006450 X:25018978-25019000 CTGGTCTGCTTGGAAAACAATGG + Intergenic
1191792234 X:64983073-64983095 CACCTGTGCTAGGAAAGGAAGGG - Intronic
1192142702 X:68659323-68659345 CTCCTCAGCCAGGGAATGAAGGG - Intronic
1192433360 X:71127234-71127256 CTGCTCAGGTGGGAAAAGAATGG + Intronic
1196324708 X:114389515-114389537 CTGCTGTTCTAGGAGCTGAAAGG - Intergenic
1196740530 X:119021231-119021253 CTGCACAGCTTGGGAATGAAGGG + Intergenic
1197318837 X:125003061-125003083 CTGCTCTGCTGGAAAATTGAGGG - Intergenic
1199481989 X:148307846-148307868 CTGCTCAGCTAGGAAGGGGAAGG - Intergenic
1200697063 Y:6370257-6370279 CTGCTCAGCTGGGAACAGAATGG + Intergenic
1200752006 Y:6954574-6954596 CAGCTCTGCTTGGCTATGAAAGG + Intronic
1200778813 Y:7195870-7195892 CAGCTCTGCTTGGCTATGAAAGG + Intergenic
1201037050 Y:9794442-9794464 CTGCTCAGCTGGGAACAGAATGG - Intergenic
1201121963 Y:10880142-10880164 GTGCTCTGGATGGAAATGAATGG - Intergenic
1201347830 Y:13004455-13004477 CAGCTCTGCTTGGCTATGAAAGG - Intergenic