ID: 1053731791

View in Genome Browser
Species Human (GRCh38)
Location 9:41064421-41064443
Sequence GGGTGGGCATGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053731776_1053731791 24 Left 1053731776 9:41064374-41064396 CCTCATGAAATGAGCAGATTAAG No data
Right 1053731791 9:41064421-41064443 GGGTGGGCATGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053731791 Original CRISPR GGGTGGGCATGGAGGGGAGA GGG Intergenic
No off target data available for this crispr