ID: 1053732847

View in Genome Browser
Species Human (GRCh38)
Location 9:41074696-41074718
Sequence CGGTCTGGCAGCGGAGAAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053732847_1053732859 21 Left 1053732847 9:41074696-41074718 CCACCTTCTCCGCTGCCAGACCG No data
Right 1053732859 9:41074740-41074762 CCCCAAGTTGGACTCACTTTCGG No data
1053732847_1053732861 22 Left 1053732847 9:41074696-41074718 CCACCTTCTCCGCTGCCAGACCG No data
Right 1053732861 9:41074741-41074763 CCCAAGTTGGACTCACTTTCGGG No data
1053732847_1053732856 9 Left 1053732847 9:41074696-41074718 CCACCTTCTCCGCTGCCAGACCG No data
Right 1053732856 9:41074728-41074750 CCCTCAGTTTCTCCCCAAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053732847 Original CRISPR CGGTCTGGCAGCGGAGAAGG TGG (reversed) Intergenic
No off target data available for this crispr