ID: 1053733121

View in Genome Browser
Species Human (GRCh38)
Location 9:41076694-41076716
Sequence GCGTGGTGGCATGTACCTGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053733121_1053733128 11 Left 1053733121 9:41076694-41076716 CCTACAGGTACATGCCACCACGC No data
Right 1053733128 9:41076728-41076750 TTGTAGTTTTTGTAGACATGGGG 0: 6
1: 268
2: 7871
3: 107908
4: 196727
1053733121_1053733126 9 Left 1053733121 9:41076694-41076716 CCTACAGGTACATGCCACCACGC No data
Right 1053733126 9:41076726-41076748 TTTTGTAGTTTTTGTAGACATGG 0: 7
1: 450
2: 14183
3: 231904
4: 143756
1053733121_1053733129 30 Left 1053733121 9:41076694-41076716 CCTACAGGTACATGCCACCACGC No data
Right 1053733129 9:41076747-41076769 GGGGTTTCACCATGTTGCCTAGG 0: 363
1: 8816
2: 91778
3: 182747
4: 226663
1053733121_1053733127 10 Left 1053733121 9:41076694-41076716 CCTACAGGTACATGCCACCACGC No data
Right 1053733127 9:41076727-41076749 TTTGTAGTTTTTGTAGACATGGG 0: 6
1: 278
2: 8676
3: 119036
4: 271590

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053733121 Original CRISPR GCGTGGTGGCATGTACCTGT AGG (reversed) Intergenic
No off target data available for this crispr