ID: 1053735429

View in Genome Browser
Species Human (GRCh38)
Location 9:41098658-41098680
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 4, 1: 1, 2: 3, 3: 25, 4: 369}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053735426_1053735429 30 Left 1053735426 9:41098605-41098627 CCTACTGGTAGGCTTGCTCTGAT No data
Right 1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG 0: 4
1: 1
2: 3
3: 25
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053735429 Original CRISPR GAGGTTTATTTTTAATTGCT AGG Intergenic
902646940 1:17806120-17806142 GCGATTAATTTTTAATGGCTTGG + Intronic
904377523 1:30091061-30091083 CAGGTTTATTTTTAAACTCTGGG + Intergenic
904918671 1:33988658-33988680 CAGGTGTTGTTTTAATTGCTGGG - Intronic
904956501 1:34288622-34288644 AATGTTTTTTTTTAATTGCCTGG + Intergenic
905541028 1:38760560-38760582 GAGATTTATTTTTAATGAATTGG + Intergenic
908007210 1:59739287-59739309 CAGATTATTTTTTAATTGCTTGG + Intronic
908577603 1:65477515-65477537 AAGGTATATTTTTAATGGGTGGG + Intronic
909857508 1:80556768-80556790 AAGTTGTATTCTTAATTGCTTGG - Intergenic
910038274 1:82815482-82815504 GAGTTTTATTTTTATTTTCAGGG - Intergenic
910390163 1:86733873-86733895 GAGCTTTTTTTTTTATTTCTTGG + Intronic
911373916 1:97027245-97027267 GAGGTTTTTTTTTGGTTGGTAGG - Intergenic
911560324 1:99397566-99397588 AATGTTTATTTTTAAATGATAGG - Intergenic
911942153 1:104060455-104060477 GAGGTTGATTTTTAAGGGGTAGG - Intergenic
912196876 1:107408428-107408450 GCGGTTTCTCTTCAATTGCTTGG - Intronic
912226593 1:107741294-107741316 GAGCTTAATTTTGAATTGCTGGG + Intronic
912743876 1:112228488-112228510 GATATTTATTTTTATGTGCTTGG - Intergenic
912927430 1:113925794-113925816 GCGATTTACTTTTAACTGCTTGG + Intergenic
913052973 1:115133120-115133142 GCTGTTTATTTTTAAATGCAGGG - Intergenic
913226178 1:116701526-116701548 GAAGTTTATTTTTTATTTTTAGG + Intronic
916248606 1:162712853-162712875 GAGATTAATTTTGACTTGCTTGG - Intronic
917831352 1:178891913-178891935 GAGGTTTTTTTTTTATTATTTGG + Intronic
918151898 1:181804143-181804165 TATGTTTATTTTTATTTGTTTGG + Intronic
918378179 1:183929872-183929894 GAGGTTTATTTTTTCTTTCACGG + Intronic
919454109 1:197802300-197802322 GACATTAATTTTTAATTGTTTGG - Intergenic
919532145 1:198736035-198736057 GAATTTTATTTTTAATTTTTTGG + Intronic
919618961 1:199843368-199843390 GATGTTTGTTTTTCTTTGCTTGG - Intergenic
920529745 1:206693226-206693248 CAGGTTTATTTTTAGCTGTTCGG - Intronic
921345722 1:214182967-214182989 AAGATTTCTTTTTATTTGCTTGG - Intergenic
922864778 1:228850600-228850622 GAGGTTGATTTTTAACTACCAGG + Intergenic
924454371 1:244207058-244207080 GAGGTCTATTTTAAATAGTTTGG - Intergenic
924568349 1:245216471-245216493 CAGTTTTATTTTTAATAGTTTGG - Intronic
1063484807 10:6409731-6409753 AAGGTTTTTTTTTTATAGCTTGG + Intergenic
1065271456 10:24037523-24037545 GAGGTTTACTTTGAATTCGTGGG - Intronic
1065780087 10:29159281-29159303 GAGGTTTCTGTTTAGTTACTTGG + Intergenic
1066792956 10:39086323-39086345 AAGTTTTATTTTTAATCACTAGG + Intergenic
1067158398 10:43801968-43801990 GAGGGTGATTCTTAACTGCTTGG + Intergenic
1067859828 10:49834570-49834592 GAGGTTTATTTTCAGTTTCATGG - Intronic
1068107293 10:52634701-52634723 AAGGTTTATTTTTAATAGTGGGG - Intergenic
1068185401 10:53578681-53578703 AAGTTTTATTTTTAAATTCTTGG - Intergenic
1068733738 10:60388779-60388801 GAGGTTTGTTTTTCCCTGCTGGG - Intronic
1068733798 10:60389323-60389345 AAGGGTTATTTTTACATGCTGGG - Intronic
1068957896 10:62836740-62836762 GTAGTTTTTTTTAAATTGCTGGG - Intronic
1069146727 10:64902056-64902078 TAGATTAATATTTAATTGCTCGG - Intergenic
1069197020 10:65563618-65563640 GGGTTTTATTTTTTATTGTTGGG - Intergenic
1069241153 10:66140788-66140810 GACTTTTCTTCTTAATTGCTTGG + Intronic
1071069288 10:81672649-81672671 GGTTTTTTTTTTTAATTGCTAGG + Intergenic
1073943795 10:108728830-108728852 TAGTTTTATTTTTAGTTCCTTGG - Intergenic
1074647209 10:115471387-115471409 TAGTTTTATTTTTAATTTTTGGG + Intronic
1078839157 11:15061997-15062019 GAAGTTTATTTTTATTTGTTTGG - Intronic
1080312169 11:30907228-30907250 CAGTTTTGTTTTTATTTGCTTGG - Intronic
1080632269 11:34088971-34088993 GAAATTTACCTTTAATTGCTGGG + Intronic
1081446567 11:43136758-43136780 GAAGTTTATTTTTAATTGCTAGG + Intergenic
1082918141 11:58461789-58461811 GAGATTTATTTTTATATACTTGG - Intergenic
1085448838 11:76619048-76619070 GAGTTTTGTTTTTACTTTCTTGG - Intergenic
1085491215 11:76919824-76919846 AATGTTTATTCTTAATTTCTTGG + Intronic
1085504178 11:77047061-77047083 GAGTTTTATTTTTTGTTGTTGGG - Intergenic
1085761923 11:79248552-79248574 GAGTTTTATTTTTGAATCCTTGG - Intronic
1086822146 11:91446963-91446985 TAGTTTTTTTTTTAATTGCCTGG - Intergenic
1087353997 11:97071294-97071316 GATTTTTTTTTTTTATTGCTAGG + Intergenic
1088160656 11:106865848-106865870 GAGTTTTGTTTTTAAATCCTGGG - Intronic
1088276686 11:108094573-108094595 GAGGTTTATTTTTAATTTACTGG - Intronic
1090627307 11:128618244-128618266 GAGATTTCTTTTTTATTGCAAGG + Intergenic
1091200928 11:133780591-133780613 GAGTTTTTTTTTTAATGTCTAGG + Intergenic
1091316893 11:134620682-134620704 TAGATTTATTTTTACTTTCTGGG - Intergenic
1091982003 12:4872248-4872270 TAGTTTTAGTTTTAATTGTTAGG - Intergenic
1092047221 12:5440406-5440428 GAAGGATATTTTTAAATGCTGGG - Intronic
1093520374 12:20043328-20043350 GAGGTTTATTCAAAAGTGCTAGG - Intergenic
1094127959 12:27043532-27043554 GAGGTCTTTTTTTGATTGGTAGG - Intronic
1094782838 12:33812796-33812818 GATTTTTATTTTTAAGTTCTGGG + Intergenic
1096445091 12:51682446-51682468 GAGGTTCATTTTTTAATGCAAGG + Intronic
1096603649 12:52748532-52748554 GCTGCTTATTTTTAAATGCTCGG - Intergenic
1097558384 12:61168959-61168981 GCTGTATATTTTTAAGTGCTTGG - Intergenic
1098122251 12:67254508-67254530 GAGATTTATTTCCAATTGTTGGG - Intergenic
1098401810 12:70084886-70084908 AAAGTTTATTTTTAATTTTTTGG + Intergenic
1098501719 12:71200208-71200230 GATGTATATTTTTAATTGGGTGG - Intronic
1098707505 12:73709014-73709036 GAAGTTTCTTTTTAAGTTCTGGG - Intergenic
1099015739 12:77341877-77341899 GAGGTTAATTTTCAAGGGCTTGG - Intergenic
1099049491 12:77766147-77766169 TAAGTTTATTTTTATTAGCTGGG - Intergenic
1099112617 12:78581074-78581096 GAGGTTTATCTTTAACTACAAGG - Intergenic
1100165699 12:91915186-91915208 GAGGTTTAGTTATAAACGCTGGG - Intergenic
1103296253 12:119889664-119889686 GGGGTTGATTTTTAACTACTAGG + Intergenic
1105050706 12:133048127-133048149 GCCTTTTATTTTTAGTTGCTGGG + Intronic
1106342780 13:28847256-28847278 GAGGTTTTTTTTTGGTTCCTTGG + Intronic
1106975502 13:35207867-35207889 GAAGTTTATTTATTATTCCTTGG + Intronic
1111761206 13:92467692-92467714 GAGTCGTATTTTTAACTGCTGGG + Intronic
1112654728 13:101438820-101438842 TAGGTCTATTTATAATTGATTGG - Intergenic
1114333972 14:21668369-21668391 GAGGAAAATTTTTATTTGCTAGG - Intergenic
1114487982 14:23075471-23075493 AAGGTGTCTTTTTCATTGCTTGG - Intronic
1115083760 14:29488674-29488696 GAGATTTAATTTTAATAGTTTGG + Intergenic
1115091180 14:29577864-29577886 AAGCTATATTTTTAAATGCTAGG - Intronic
1115208450 14:30940027-30940049 GTGTTTTTTTTTTAATTGCCTGG + Intronic
1115212406 14:30980906-30980928 AAGTTTTTTTTTTAATTCCTTGG - Intronic
1115446708 14:33498870-33498892 AAGGTTTATTTTTAAAATCTGGG + Intronic
1115578490 14:34734708-34734730 GATTTTGATTTTTAATTTCTGGG + Intergenic
1116157957 14:41232492-41232514 GAGGTTAATTTTTACTTGTGTGG - Intergenic
1116434313 14:44879063-44879085 GAATTTGATTATTAATTGCTTGG - Intergenic
1117247435 14:53900111-53900133 GAAGTTTATTTTTAAAAGCAAGG + Intergenic
1117269270 14:54125079-54125101 CATGTTTATTTTTCATTGGTGGG - Intergenic
1118268957 14:64323546-64323568 AAGGATTATTTTTATTTGCATGG + Intronic
1118541053 14:66826145-66826167 CAGTATTATTTTTAATTCCTTGG + Intronic
1119094675 14:71817973-71817995 GAGGCATATTTTTAATTTTTAGG + Intergenic
1119338176 14:73852126-73852148 GGGGTTTTTTTTGAATTACTGGG + Intronic
1120129007 14:80782892-80782914 GCCTTTTATTTTTATTTGCTAGG + Intronic
1120540722 14:85747450-85747472 TAGTTCTATTTTTAATTGTTGGG + Intergenic
1120542348 14:85765896-85765918 GAGGTTTATTTTGAATTGGTGGG + Intergenic
1121971728 14:98363969-98363991 TAAGTGTATTTTTAATTACTGGG - Intergenic
1124584184 15:30990548-30990570 GATGTATATGTTTAATTGCTTGG - Intronic
1127512804 15:59658918-59658940 GAGATTTTTTTTTAATTAATGGG - Intergenic
1128542895 15:68549371-68549393 GGGGTTTTTTTTTAATTGGTTGG + Intergenic
1128852552 15:70974248-70974270 AAGGTCTATTTGTAATTTCTAGG - Intronic
1129305089 15:74654486-74654508 CGGGTTTAATTTAAATTGCTAGG - Intronic
1131422842 15:92321610-92321632 GAGGTTTATTTTGAAATGTTTGG + Intergenic
1131423673 15:92328013-92328035 GAGGTTTCGATTTAGTTGCTGGG - Intergenic
1131572409 15:93552573-93552595 TAGTTTTATTTTTGTTTGCTTGG + Intergenic
1131828561 15:96339838-96339860 GTGGTTTAATTCTAATTGGTGGG + Exonic
1132077528 15:98834823-98834845 GAGGTTTGGTTTTTATTGCTAGG - Intronic
1134019804 16:10913634-10913656 GAGTTTTATTTTTAACTGTGAGG - Intronic
1135467704 16:22701552-22701574 GAGGTTTATGTTTTTCTGCTTGG - Intergenic
1137259700 16:46815034-46815056 GAGGTTTATTTTTATTCCTTTGG - Intronic
1138499716 16:57432567-57432589 GAGTTTTTTCTTTTATTGCTTGG - Intronic
1139294173 16:65885650-65885672 GAGGTTGATTTTAACTTGCTTGG - Intergenic
1139521494 16:67485168-67485190 GAGGTGTGATTTTAATTTCTTGG - Intergenic
1139841822 16:69887973-69887995 GAATTTTATTTATACTTGCTAGG - Intronic
1141957403 16:87382322-87382344 GTGGTTTATTTTTGACTGCTGGG + Intronic
1142782066 17:2189172-2189194 CAGGTTTATTTTTTAGCGCTAGG - Intronic
1143931367 17:10430927-10430949 GAGGTTTTTTTTTCATGGATGGG + Intergenic
1148277965 17:46323045-46323067 GAGATTTATTTTTACTTAGTTGG + Intronic
1148300172 17:46540899-46540921 GAGATTTATTTTTACTTAGTTGG + Intronic
1149199952 17:54173391-54173413 GAGGTTAATTTTAAACAGCTTGG - Intergenic
1149671505 17:58416922-58416944 CAGGTTCATGTTCAATTGCTTGG - Exonic
1150978267 17:70112953-70112975 GAATTTTAATTTTAATTCCTTGG - Intronic
1152041223 17:77904625-77904647 GAGGTTTATTTTTTCTCCCTAGG - Intergenic
1156767461 18:40674725-40674747 CTGGTTTATTTGCAATTGCTGGG - Intergenic
1157608851 18:48943466-48943488 TAGGTTTTGCTTTAATTGCTTGG - Intronic
1157660456 18:49437460-49437482 GACATTTATTTTTTATTACTTGG - Intronic
1158778649 18:60619192-60619214 CCGGATTATTTTTAATCGCTAGG - Intergenic
1158999829 18:62963278-62963300 CAGGTGTATTTTTTATTTCTTGG + Intronic
1159516692 18:69468416-69468438 GAATTTTATTTTTAATTTATAGG - Intronic
1161636417 19:5392189-5392211 GAGGTTTTTTTTTTTTTTCTTGG + Intergenic
1164022962 19:21325024-21325046 CAGGTGTATTTTTTATGGCTTGG - Intronic
1164141707 19:22473961-22473983 GAGGTTTTTTTTTATTAGGTGGG + Intronic
1164219787 19:23183331-23183353 GAGTTTTCTTTTTAATATCTGGG + Intergenic
1165799447 19:38538643-38538665 TAGATTTATTTTTAAATGCCAGG - Intronic
1165815296 19:38638239-38638261 AAAGTTTATTTTAAATAGCTAGG + Intergenic
1166612080 19:44207534-44207556 GGGGTTTCTCTTTAGTTGCTGGG + Intronic
1167516297 19:49924953-49924975 GTGGGTAATTTTTAATAGCTTGG - Intronic
1168438474 19:56342423-56342445 GATCTTTATTTTTAAATTCTTGG + Intronic
925278521 2:2667314-2667336 GAGGTTTATTGTCAAATGCAAGG + Intergenic
925567443 2:5271553-5271575 GATGTTAATTTTTAACTACTCGG + Intergenic
926854281 2:17235821-17235843 AAGGTTTATTCTTAATTCCTGGG - Intergenic
927062244 2:19434527-19434549 GATGTTAATTTTTAATCACTTGG + Intergenic
927164300 2:20301544-20301566 GAGATTTATGATTAATTGGTAGG - Intronic
927743439 2:25592315-25592337 TAGGTTTTAATTTAATTGCTAGG + Intronic
928349290 2:30533829-30533851 AATGTTTATTTTAAATGGCTAGG + Intronic
929070353 2:38022978-38023000 GCTGTTTATGTTTAATTGATTGG + Intronic
929632749 2:43481857-43481879 AAGGTTTATTTTTGACTTCTTGG - Intronic
930400750 2:50882164-50882186 GAGGTTGATTTTGAAATGTTAGG - Intronic
930927678 2:56839073-56839095 CAGTTTTATTTTTAATTACATGG + Intergenic
931880722 2:66567623-66567645 CTGGTTTAATTTTAATTGCCAGG - Intronic
931894139 2:66710471-66710493 GAATTTTATTTTTAATTTCTTGG - Intergenic
932785792 2:74602349-74602371 GAGATTTGTTTTTAATGGCCAGG - Intronic
933193495 2:79363558-79363580 GAGATTTTTTTTTTTTTGCTGGG - Intronic
933347581 2:81108659-81108681 GAGGTTTGTCTTTATGTGCTTGG + Intergenic
935138071 2:100324902-100324924 GTGTTTTATTTTTAAGTTCTGGG - Intergenic
936558645 2:113517602-113517624 GAGGTTTATTTTTAATTGCTAGG - Intergenic
936768946 2:115888375-115888397 GAGACTTATTTTTCCTTGCTTGG + Intergenic
938865767 2:135418448-135418470 GAGGTTTTTTTTTAAAATCTAGG + Intronic
939169004 2:138672302-138672324 GAGGTATATTTTGAATTAATAGG + Intronic
939829986 2:147060204-147060226 GAGGGCTATTTTTAATTCATTGG - Intergenic
940691905 2:156928723-156928745 GCGGTTTATTTTTTATTTTTTGG + Intergenic
941138095 2:161742075-161742097 GAAGTTTATTTTTCTATGCTTGG + Intronic
941305784 2:163864520-163864542 AAGGTTTATTTTTAATCAATAGG - Intergenic
942080440 2:172395230-172395252 GAGCTTTATTTTCATCTGCTTGG - Intergenic
942391605 2:175500908-175500930 GAGTTTGATTATTAAATGCTTGG + Intergenic
942662864 2:178284585-178284607 GAGGTTTATATTTAATTGGAGGG + Intronic
942896984 2:181069201-181069223 GGAGTTTACTTTCAATTGCTAGG + Intronic
943118755 2:183708136-183708158 GAGATTTATTTTTACTTGCTTGG - Intergenic
943541664 2:189222849-189222871 GAGATCTATTTTTCATTGCTTGG - Intergenic
943959220 2:194239785-194239807 TATTTTTATTTTTAATTACTTGG - Intergenic
944613923 2:201440617-201440639 GAATTTTACTGTTAATTGCTAGG + Intronic
945700668 2:213166771-213166793 GAAGTTTATTTTTCATTGCAGGG + Intergenic
946584727 2:221172280-221172302 GAGGTTAATTTTTAAATCCTTGG + Intergenic
946883350 2:224198070-224198092 GACTTATATTTTTAATTGCCAGG - Intergenic
947102158 2:226632387-226632409 GTGGTTTATTTTTCATCTCTGGG - Intergenic
947883107 2:233538431-233538453 TAGCTTTCTTTTTCATTGCTGGG - Intronic
948343425 2:237274554-237274576 GATGGTTATTTTTAATTATTTGG - Intergenic
1168990287 20:2089331-2089353 GATGCTTAATTTTAATTTCTGGG - Intergenic
1170415992 20:16142938-16142960 GAGGTTTATGTTTACAAGCTTGG + Intergenic
1170490469 20:16868034-16868056 TGGGTTTTTTTTTAATTGTTTGG + Intergenic
1170528727 20:17267671-17267693 GATGTTCATTTTTAAATGATGGG + Intronic
1173065513 20:39706802-39706824 GTGGTTTCTTTTTAACTGCATGG + Intergenic
1173109514 20:40173699-40173721 GGGGTTTATCTGTAATTCCTCGG - Intergenic
1173990667 20:47300622-47300644 GACTTTTCTTTTTAATGGCTAGG + Intronic
1176379173 21:6103222-6103244 GAGTTTCATTTTTAACTGCATGG + Intergenic
1177124041 21:17173404-17173426 GAGGTGTGTTTTTAATTGATGGG + Intergenic
1177375947 21:20271032-20271054 TAGGTTGATTTTTAACTACTGGG - Intergenic
1179744300 21:43435015-43435037 GAGTTTCATTTTTAACTGCATGG - Intergenic
1180204975 21:46254261-46254283 TAGGTTTATGTTTTAATGCTTGG - Intronic
1182046676 22:27279652-27279674 GTGTGTTTTTTTTAATTGCTGGG + Intergenic
1184636806 22:45839124-45839146 GAGGTTTACTATTATTGGCTTGG + Intronic
955441000 3:58955547-58955569 GAACTTAAGTTTTAATTGCTGGG - Intronic
955606216 3:60707482-60707504 CATGGTTATTTTTAATTTCTAGG + Intronic
956333659 3:68139746-68139768 GAGGCTTGTTATTGATTGCTTGG - Intronic
957110119 3:75944507-75944529 CAGGTTTTTTTTTAAGTCCTTGG - Intronic
957229629 3:77495203-77495225 CAGGTTTATTTTAAATAACTGGG + Intronic
958776683 3:98492640-98492662 AAGTTCTATTTTTAATTGTTTGG - Intergenic
958812169 3:98873496-98873518 CAGGTTTATTTCTAATTGGAAGG - Intronic
958904034 3:99922447-99922469 GAGGTTTATTTTTCACTACACGG - Intronic
959142635 3:102505189-102505211 GAGTTTTATTTTTAATGCCTTGG - Intergenic
959350217 3:105252615-105252637 GAGGTTTATTTTCAAATAGTGGG + Intergenic
959546635 3:107604114-107604136 GAGATTTTAATTTAATTGCTTGG + Intronic
959861267 3:111217500-111217522 GATTTATATTTTTAAATGCTTGG - Intronic
960353412 3:116621339-116621361 GAGTTTTTTTTTTAACTGCCAGG - Intronic
960432205 3:117582858-117582880 AAGGTTTTCTTTTAATTTCTTGG + Intergenic
960465790 3:117995835-117995857 GGGTTTCATTTTTCATTGCTGGG - Intergenic
960734666 3:120765341-120765363 GGGATTTATTTTTATTTGTTTGG + Intronic
960799018 3:121519227-121519249 GAAGATGATTTTTAATTTCTAGG - Intronic
961602834 3:128074249-128074271 ATAGTTTATTTTTTATTGCTGGG - Intronic
962012391 3:131404705-131404727 GAAGTTCATTTTTATTTGCAGGG + Intergenic
962293051 3:134153765-134153787 GAGGTTTATTTTTCACCACTTGG - Intronic
963534073 3:146505910-146505932 AAGGTTTATTTTTCATAGATAGG - Intergenic
963836407 3:150062174-150062196 GAGGTTAGTTTTTAATTTTTTGG + Intergenic
963972949 3:151449707-151449729 AAGGATTATTTATAATTCCTTGG + Intronic
964187077 3:153958966-153958988 GAGCTTTGTTTTTTATGGCTGGG - Intergenic
964237586 3:154551181-154551203 CATTTTAATTTTTAATTGCTTGG - Intergenic
964288159 3:155143950-155143972 GTGCTTTATTTTTCATTGTTAGG + Intronic
964321229 3:155499433-155499455 GAGTTTTACTTATAATTTCTAGG - Intronic
964635259 3:158851312-158851334 GAGGTGTAATTTTTCTTGCTGGG - Intergenic
964986347 3:162745055-162745077 GAGGTTTCTTTTTCAGTGCCTGG + Intergenic
965704079 3:171488535-171488557 GAGGGTTAATTTTACTTCCTGGG + Intergenic
967691685 3:192481517-192481539 GAGAATTATTATTAATTGATTGG - Intronic
969544680 4:7817809-7817831 AAGGTTTTTTTTTAATGGTTTGG - Intronic
969755639 4:9148391-9148413 GAGGATTATGAGTAATTGCTTGG - Intergenic
970215903 4:13760251-13760273 GAGGATCCTTTTTAATTGCTTGG + Intergenic
970295552 4:14625543-14625565 GAGGGTTATTTTACTTTGCTAGG + Intergenic
970642981 4:18088262-18088284 GAGGATTTTTTTTAAGTTCTAGG - Intergenic
971008882 4:22407632-22407654 GAACTTTATTTTTCATTTCTTGG - Intronic
971276984 4:25207910-25207932 GAGGTTTATTTTTTAGAGGTAGG - Intronic
973051464 4:45603399-45603421 AAGATATATTTTTAATTCCTGGG + Intergenic
973087516 4:46084606-46084628 TAAGTGTATTTTTAATTGCAAGG - Intronic
975961714 4:79917063-79917085 GAAGTTTATTTTAATTTGTTGGG - Intronic
976673192 4:87676423-87676445 TAGTTTTATTTTTAGTTCCTTGG - Intergenic
977069134 4:92360928-92360950 GTGTTCTATTTTAAATTGCTTGG + Intronic
977519175 4:98059176-98059198 GATGTTTATTTTTAATTCTGTGG - Intronic
978020237 4:103800362-103800384 GAGGTTTTATAATAATTGCTGGG + Intergenic
978655176 4:111057437-111057459 CAGTTTTATTTTTAATTTTTGGG - Intergenic
978850159 4:113325842-113325864 CAGGATTATTTTTCATTGCCAGG + Intronic
979094345 4:116527268-116527290 TAGGTTTTTTTTTAGATGCTAGG + Intergenic
979535531 4:121815968-121815990 GAGTTTTATTTTTATTTTTTGGG + Intronic
979545484 4:121935205-121935227 AAATTTTATTTTTAATTCCTTGG + Intronic
980144039 4:128958567-128958589 GATGTTTATTTTTAATGGCTTGG + Intronic
980673767 4:136047608-136047630 GACTTTTAGTTTGAATTGCTAGG - Intergenic
981018383 4:139999611-139999633 AACATTTATTTTTAAATGCTGGG + Intronic
981081028 4:140639586-140639608 GATATTTATTTCTGATTGCTCGG - Intronic
981305585 4:143243771-143243793 TAGTTTTTTTTTTAATTGATGGG + Intergenic
982484038 4:155945813-155945835 GAAGTTTATTTAGAAATGCTAGG + Intronic
982614261 4:157620825-157620847 GAGGTATATTTTCAATTACCAGG + Intergenic
983382483 4:167015039-167015061 GATGTTTATTTCTGATTGCATGG - Intronic
983768081 4:171512124-171512146 GGGGTTGATTTTTAACTACTAGG + Intergenic
983806159 4:171995335-171995357 TAGGTATGTTTTTAATTTCTAGG - Intronic
984040694 4:174729706-174729728 GAGGTCTATATTTAATTTATTGG - Intronic
984181245 4:176485001-176485023 GATGTTTTTGATTAATTGCTAGG + Intergenic
984362651 4:178756123-178756145 GGGGTTTATTTTTATTTGCACGG + Intergenic
984365953 4:178800479-178800501 CAGGTATATTTTTATTTGATGGG + Intergenic
984848423 4:184128954-184128976 AAGGTTTCTTTTTAATTTATAGG - Intronic
985378990 4:189372575-189372597 AGGATTTATTTTTTATTGCTTGG - Intergenic
987212425 5:15696367-15696389 GAGGATTATTTTGAATTGGAAGG + Intronic
987426260 5:17776867-17776889 CAGGTTTTTTTTTTATTGCAGGG + Intergenic
988193811 5:27974735-27974757 GAGTTTTATTTTATATTTCTTGG + Intergenic
988449430 5:31326018-31326040 AGGTTTTTTTTTTAATTGCTAGG + Exonic
989328663 5:40229298-40229320 GATGTTTATTTTTAATAGAGAGG + Intergenic
990972759 5:61527310-61527332 GAGGGATAGTTTTAGTTGCTGGG + Intronic
991178557 5:63720847-63720869 GCCGTTTATTTTTAAATGTTTGG + Intergenic
991488039 5:67158250-67158272 AAGGTTTATTTTTAATGTTTTGG + Intronic
991638438 5:68730072-68730094 TCATTTTATTTTTAATTGCTTGG - Intergenic
993116066 5:83721850-83721872 GACGTTTATTTATAACTTCTGGG + Intergenic
993766438 5:91864268-91864290 GAGGTTATGTTTTATTTGCTAGG + Intergenic
994295893 5:98087810-98087832 CAGCTTTATCTTTAATTCCTAGG - Intergenic
996045261 5:118864867-118864889 AACTTTTCTTTTTAATTGCTAGG + Intronic
996855948 5:128007055-128007077 GATCTTTATTTTTAATTAGTTGG + Intergenic
999397360 5:151238550-151238572 AAGTTTTATTTTTAGCTGCTGGG - Intronic
999751628 5:154631976-154631998 GCGCTTTATTCTTTATTGCTGGG - Intergenic
1000341973 5:160284871-160284893 AACTTTTTTTTTTAATTGCTTGG + Intronic
1000349143 5:160339147-160339169 GAGGTTTAATTGCAAGTGCTAGG - Intronic
1000428147 5:161116746-161116768 CAGATTTTTTTTTAATTGTTAGG - Intergenic
1000567820 5:162872663-162872685 GAGTTTTATTTTGAATAGCAAGG - Intergenic
1000739103 5:164943558-164943580 GAGGACTATTTAGAATTGCTAGG + Intergenic
1000760124 5:165213037-165213059 TACATTTGTTTTTAATTGCTTGG + Intergenic
1000804995 5:165779164-165779186 AAGGTTTATTTTTAGCTTCTTGG + Intergenic
1001089147 5:168724370-168724392 GATGTTTATTTTTCCCTGCTGGG - Intronic
1002317815 5:178355529-178355551 GAGGTTTGTTTTTATTTTTTTGG + Intronic
1003491355 6:6624965-6624987 GATATTTGATTTTAATTGCTTGG - Exonic
1004413314 6:15401450-15401472 AACATTTATTTTTAAATGCTGGG - Intronic
1004634149 6:17450606-17450628 GAGGTTTATTCTTCATTAATAGG - Intronic
1005425887 6:25702051-25702073 GGGGTTTGTTCTTAAGTGCTTGG + Intergenic
1005720112 6:28593377-28593399 GAGTTTTTTTTTTTTTTGCTGGG + Intronic
1008455141 6:51701460-51701482 GAGGATTATTTTAAATGACTTGG - Intronic
1008479730 6:51973087-51973109 ATGGTTTATTTTTAATCACTGGG - Intronic
1008763363 6:54880744-54880766 AAGGTTTATTTTTTATTATTAGG + Intronic
1009427296 6:63528383-63528405 CAGGCTGATTTCTAATTGCTGGG - Intronic
1009963555 6:70553727-70553749 AAATTTTATTTTTAATTGTTTGG - Intronic
1010267202 6:73880232-73880254 TATTTTTATTTTTAATTGCCTGG - Intergenic
1010493895 6:76509036-76509058 TGGGTTTCTTTTTAATTGGTGGG + Intergenic
1010617999 6:78037114-78037136 AAGAATTATTTCTAATTGCTTGG - Intergenic
1010743931 6:79539502-79539524 GAGTTTTATTTTTAATATCCTGG + Intergenic
1010807341 6:80253459-80253481 GAGTTTTATTTATAATTCTTGGG + Intronic
1011232422 6:85178009-85178031 GAGTTTTATTCTTAAATGCCTGG + Intergenic
1012526153 6:100180352-100180374 GAGGTTTCTTTTTATAAGCTGGG - Intergenic
1012902106 6:105018497-105018519 GAGGTGTATTTTTGAGTGCATGG - Intronic
1013384105 6:109607199-109607221 TAGGTTTATTTTTTATTTTTAGG - Intronic
1013862791 6:114656993-114657015 AAGGTTTATTTTTAATAATTAGG + Intergenic
1014046083 6:116888892-116888914 GAGGTTTATCTTTAGTGACTAGG + Intronic
1014237982 6:118982186-118982208 GTGGTTTATTTTTTCTTTCTAGG - Intronic
1014365191 6:120531408-120531430 CAGATTTATTTTAAATTCCTTGG + Intergenic
1014571347 6:123012490-123012512 GTGTTTTTTTTTTAATTTCTTGG - Intronic
1014634741 6:123831394-123831416 AGGATTTATTTTTAATTTCTGGG + Intronic
1014716956 6:124877664-124877686 GTTGTTTATTTTAAAGTGCTTGG + Intergenic
1015428833 6:133105797-133105819 GTTTTTTATTTTTAATTGTTTGG + Intergenic
1018088408 6:160325074-160325096 GAGGCTCATATTTAATGGCTGGG - Intergenic
1019101565 6:169635062-169635084 AAAGTTTATTTTTACTTACTGGG - Intronic
1020468240 7:8505455-8505477 GAGGTCTATTATTTATTTCTAGG - Intronic
1021133152 7:16935102-16935124 GAGGCCTACTTTTAATTGCTTGG + Intergenic
1022041896 7:26589280-26589302 GATCTTTGTTTTTATTTGCTTGG + Intergenic
1023110273 7:36803214-36803236 GAGGCTTATTTTTAGTGGATAGG - Intergenic
1023404389 7:39816762-39816784 AATGTTTATTTTGAATTCCTAGG + Intergenic
1023445940 7:40231728-40231750 GAGGTTTATTTTAAGTGACTTGG + Intronic
1023740451 7:43276336-43276358 GAGGTCTCTATTTACTTGCTGGG - Intronic
1023950894 7:44844039-44844061 GAGGTTTTTTTTTTTTTTCTTGG - Intronic
1024122562 7:46260096-46260118 TAGCTTTTTTTTTAGTTGCTTGG + Intergenic
1024454647 7:49589982-49590004 TAGGTCTATTTTTAATTTTTAGG - Intergenic
1024699196 7:51888695-51888717 GAATTTTATTTTAAAATGCTGGG - Intergenic
1024769229 7:52698603-52698625 GATGTTTGTTGTTAATTGCCTGG - Intergenic
1027464050 7:78492483-78492505 GAGGATTATTTTTAATGCATTGG + Intronic
1028976045 7:96915415-96915437 GAGCTTTATTTTTATTTACTTGG - Intergenic
1029109246 7:98203922-98203944 GGGTTTTATTTTTTATTTCTAGG + Exonic
1029274259 7:99394835-99394857 GAGGTTTTTTGTTATTTCCTTGG + Intronic
1029670404 7:102026467-102026489 GAGTTTTATTTCTAATGGCAAGG + Intronic
1030282115 7:107787576-107787598 CATGTTTATTTTTATTTGTTTGG - Intronic
1030577976 7:111313891-111313913 GGGGTGTATGTTTAATGGCTTGG + Intronic
1030813257 7:114002840-114002862 GAGCTTTTTTTTTGATTGGTAGG - Intronic
1030883248 7:114907091-114907113 GATTTTTATGTTGAATTGCTTGG - Intergenic
1031795250 7:126165908-126165930 GAAAATTATTTTTAATTGGTAGG + Intergenic
1032549518 7:132771553-132771575 GAGTTTTATTTAGAATGGCTGGG + Intergenic
1034122761 7:148642491-148642513 GAGGTTTATTCTTGGTTTCTGGG + Intergenic
1035955355 8:4071760-4071782 GGGTTTTATTTTTTATTCCTTGG + Intronic
1035999566 8:4585289-4585311 TAGCTTAATTTTTAATTTCTGGG - Intronic
1036092906 8:5688488-5688510 GAAATTTATTTTTAATTTCAGGG - Intergenic
1036124781 8:6052673-6052695 GAGGTTTGATTTTAACTCCTCGG - Intergenic
1036295359 8:7530383-7530405 GAGGTCAAGTTTTAATTTCTGGG + Intergenic
1036327211 8:7790635-7790657 GAGGTCAAGTTTTAATTTCTGGG - Intergenic
1037385770 8:18338960-18338982 GATGATTATTTTGAATTGTTAGG - Intergenic
1038028998 8:23620414-23620436 GAGTTTCATTTTTAAAAGCTGGG + Intergenic
1038071554 8:24020136-24020158 AATGTTTGTTTTTAATTGTTTGG - Intergenic
1038130948 8:24730976-24730998 GAGTTTTATTTTTAACTACTAGG + Intergenic
1038619220 8:29124351-29124373 CAGTTTTATTTCTAATGGCTTGG + Intronic
1039325182 8:36477483-36477505 GTGGGTTTTTTTTATTTGCTTGG + Intergenic
1039415806 8:37393313-37393335 GAGGTTAATTTATCATCGCTGGG - Intergenic
1039532673 8:38277581-38277603 GCTTTTTATTTTTAATTGCAAGG + Intronic
1039877224 8:41597082-41597104 GGGGTTGATTTTTAACTACTAGG + Intronic
1040082153 8:43297229-43297251 AATGTTTATTTTGAATTCCTAGG + Intergenic
1040759703 8:50824530-50824552 CAAGATTATTTTTAATTGCTTGG + Intergenic
1042417780 8:68544291-68544313 GAGATTTATTCTTTCTTGCTGGG - Intronic
1043347364 8:79314903-79314925 TAGGTTTATTTTTAATTCTGAGG - Intergenic
1044190182 8:89306770-89306792 CAGTTTTATTTTTAATTGGCAGG - Intergenic
1044641920 8:94391803-94391825 GATATTTATTTATAATTTCTTGG + Exonic
1045159475 8:99522421-99522443 GAGTTGTATTTTTACTTTCTGGG + Intronic
1045792857 8:106005884-106005906 GAGTTTTATTATTAAGTGCCTGG - Intergenic
1046142865 8:110118546-110118568 GTTGTTTATTTCTAATTTCTAGG - Intergenic
1046966773 8:120176417-120176439 GAGGTATATTTTCACTTACTGGG + Intronic
1048612298 8:136036039-136036061 GAGTTTTATTTTTGAGAGCTTGG + Intergenic
1049894202 9:98569-98591 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1051145897 9:14027116-14027138 GTTGGTTATTTGTAATTGCTGGG + Intergenic
1051581792 9:18684087-18684109 GAAGTTTGTTTTGAATTGTTTGG + Intronic
1051820262 9:21157538-21157560 GAGTCTTATTTTTGTTTGCTTGG - Intergenic
1052539427 9:29789426-29789448 ATGGATTATTATTAATTGCTTGG - Intergenic
1052545665 9:29874509-29874531 GAGCTTTATTTTCCATGGCTGGG + Intergenic
1052921352 9:33972659-33972681 GAGGTTTATTTCTTGTTTCTGGG - Intronic
1053735429 9:41098658-41098680 GAGGTTTATTTTTAATTGCTAGG + Intergenic
1054692949 9:68332743-68332765 GAGGTTTATTTTTAATTGCTAGG - Intronic
1055162984 9:73154254-73154276 GGAGTTTATTTTTAAATGCACGG - Intronic
1057015049 9:91643889-91643911 GTGGTTTATTTATAACTGCTGGG - Intronic
1057992565 9:99785713-99785735 TAAGTTTTTTTTTAAATGCTGGG - Intergenic
1058075032 9:100642357-100642379 CAGGTTTTTTTTTAATTTCCTGG - Intergenic
1058205950 9:102107732-102107754 CATGTTTCTTTTTAATTGCAAGG + Intergenic
1058685750 9:107478242-107478264 GAGGTGTATTCTTAAGAGCTGGG + Intergenic
1058774188 9:108267757-108267779 AACGCTTATTTTTAAATGCTAGG - Intergenic
1059086863 9:111312680-111312702 GAGAAAAATTTTTAATTGCTAGG + Intergenic
1059519808 9:114930498-114930520 GAGGTTCATTTTTCATTGCCAGG + Intronic
1186971009 X:14843042-14843064 GAAGTTGATTTTTACATGCTAGG + Intergenic
1188088259 X:25929495-25929517 GAAGTTTATATTCAATTCCTAGG + Intergenic
1188773283 X:34181719-34181741 GAGGTTTATGTTTTAGTGATCGG - Intergenic
1190923045 X:54875166-54875188 TTGGTTTATTTTTCATTGCAAGG - Intergenic
1190961975 X:55260653-55260675 GTTTTTTATTTTTAAGTGCTAGG - Exonic
1194569503 X:95536690-95536712 GAGGTGTATTTTTGTTTGATAGG + Intergenic
1194883492 X:99283153-99283175 GTGTTTTAATATTAATTGCTCGG + Intergenic
1195058777 X:101173807-101173829 CAGGTTTTTTTTTGATTGGTAGG - Intergenic
1197089059 X:122515002-122515024 GACTTCTTTTTTTAATTGCTGGG - Intergenic
1197846872 X:130812437-130812459 AAAGTTTATTCTTAGTTGCTAGG - Intronic
1199229293 X:145417360-145417382 CAGGTTGGTTTTTAATTCCTGGG - Intergenic
1199921807 X:152413888-152413910 GAGATTTTTTTTTTATTCCTCGG - Intronic
1200297273 X:154933052-154933074 GGAGTTTAGTTTTAATGGCTTGG + Intronic
1201450453 Y:14106739-14106761 GAGGTTTATTGCCATTTGCTGGG + Intergenic