ID: 1053737830

View in Genome Browser
Species Human (GRCh38)
Location 9:41112755-41112777
Sequence CTAAATATACAGCTTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053737827_1053737830 -6 Left 1053737827 9:41112738-41112760 CCCCATGGGATATTGTTCTAAAT No data
Right 1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG No data
1053737828_1053737830 -7 Left 1053737828 9:41112739-41112761 CCCATGGGATATTGTTCTAAATA No data
Right 1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG No data
1053737829_1053737830 -8 Left 1053737829 9:41112740-41112762 CCATGGGATATTGTTCTAAATAT No data
Right 1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG No data
1053737824_1053737830 16 Left 1053737824 9:41112716-41112738 CCAGTATCGAAGACATGTACAGC No data
Right 1053737830 9:41112755-41112777 CTAAATATACAGCTTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053737830 Original CRISPR CTAAATATACAGCTTGAAAA AGG Intergenic
No off target data available for this crispr