ID: 1053748997

View in Genome Browser
Species Human (GRCh38)
Location 9:41234982-41235004
Sequence GGCTCATGAAAGCCCCCTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053748997_1053749007 17 Left 1053748997 9:41234982-41235004 CCCACAGGGGGCTTTCATGAGCC No data
Right 1053749007 9:41235022-41235044 CCCTGTCCTCTTGGTGCTGTGGG No data
1053748997_1053749005 16 Left 1053748997 9:41234982-41235004 CCCACAGGGGGCTTTCATGAGCC No data
Right 1053749005 9:41235021-41235043 TCCCTGTCCTCTTGGTGCTGTGG No data
1053748997_1053749003 8 Left 1053748997 9:41234982-41235004 CCCACAGGGGGCTTTCATGAGCC No data
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053748997 Original CRISPR GGCTCATGAAAGCCCCCTGT GGG (reversed) Intergenic
No off target data available for this crispr