ID: 1053749003

View in Genome Browser
Species Human (GRCh38)
Location 9:41235013-41235035
Sequence AGGGCTCCTCCCTGTCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053748990_1053749003 28 Left 1053748990 9:41234962-41234984 CCCTGCGCTCCTGGGGCTCTCCC No data
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data
1053748997_1053749003 8 Left 1053748997 9:41234982-41235004 CCCACAGGGGGCTTTCATGAGCC No data
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data
1053748991_1053749003 27 Left 1053748991 9:41234963-41234985 CCTGCGCTCCTGGGGCTCTCCCA No data
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data
1053748996_1053749003 19 Left 1053748996 9:41234971-41234993 CCTGGGGCTCTCCCACAGGGGGC 0: 39
1: 14
2: 12
3: 31
4: 249
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data
1053748998_1053749003 7 Left 1053748998 9:41234983-41235005 CCACAGGGGGCTTTCATGAGCCA No data
Right 1053749003 9:41235013-41235035 AGGGCTCCTCCCTGTCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053749003 Original CRISPR AGGGCTCCTCCCTGTCCTCT TGG Intergenic
No off target data available for this crispr