ID: 1053749007

View in Genome Browser
Species Human (GRCh38)
Location 9:41235022-41235044
Sequence CCCTGTCCTCTTGGTGCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053749002_1053749007 -4 Left 1053749002 9:41235003-41235025 CCAGGCAGCAAGGGCTCCTCCCT No data
Right 1053749007 9:41235022-41235044 CCCTGTCCTCTTGGTGCTGTGGG No data
1053748997_1053749007 17 Left 1053748997 9:41234982-41235004 CCCACAGGGGGCTTTCATGAGCC No data
Right 1053749007 9:41235022-41235044 CCCTGTCCTCTTGGTGCTGTGGG No data
1053748998_1053749007 16 Left 1053748998 9:41234983-41235005 CCACAGGGGGCTTTCATGAGCCA No data
Right 1053749007 9:41235022-41235044 CCCTGTCCTCTTGGTGCTGTGGG No data
1053748996_1053749007 28 Left 1053748996 9:41234971-41234993 CCTGGGGCTCTCCCACAGGGGGC 0: 39
1: 14
2: 12
3: 31
4: 249
Right 1053749007 9:41235022-41235044 CCCTGTCCTCTTGGTGCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053749007 Original CRISPR CCCTGTCCTCTTGGTGCTGT GGG Intergenic
No off target data available for this crispr