ID: 1053749303

View in Genome Browser
Species Human (GRCh38)
Location 9:41236443-41236465
Sequence TGCTCTCCTTCTGCAGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053749303_1053749311 11 Left 1053749303 9:41236443-41236465 CCTCCTGCTGCAGAAGGAGAGCA No data
Right 1053749311 9:41236477-41236499 GATGGAGAAGTAGAACCAGAGGG No data
1053749303_1053749309 -7 Left 1053749303 9:41236443-41236465 CCTCCTGCTGCAGAAGGAGAGCA No data
Right 1053749309 9:41236459-41236481 GAGAGCAAGGGAGAGAGGGATGG No data
1053749303_1053749310 10 Left 1053749303 9:41236443-41236465 CCTCCTGCTGCAGAAGGAGAGCA No data
Right 1053749310 9:41236476-41236498 GGATGGAGAAGTAGAACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053749303 Original CRISPR TGCTCTCCTTCTGCAGCAGG AGG (reversed) Intergenic
No off target data available for this crispr