ID: 1053750677

View in Genome Browser
Species Human (GRCh38)
Location 9:41251360-41251382
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053750677_1053750690 29 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750677_1053750687 10 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750687 9:41251393-41251415 AAACCTGTGAATTTGGGAGAGGG No data
1053750677_1053750686 9 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750686 9:41251392-41251414 GAAACCTGTGAATTTGGGAGAGG No data
1053750677_1053750689 26 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750689 9:41251409-41251431 GAGAGGGAGAGCACAGTGACTGG No data
1053750677_1053750685 4 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750685 9:41251387-41251409 ACACAGAAACCTGTGAATTTGGG No data
1053750677_1053750684 3 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750684 9:41251386-41251408 CACACAGAAACCTGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053750677 Original CRISPR TGTGGCTGCTGCTAGGTGGG GGG (reversed) Intergenic