ID: 1053750679

View in Genome Browser
Species Human (GRCh38)
Location 9:41251362-41251384
Sequence TGTGTGGCTGCTGCTAGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053750679_1053750687 8 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750687 9:41251393-41251415 AAACCTGTGAATTTGGGAGAGGG No data
1053750679_1053750686 7 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750686 9:41251392-41251414 GAAACCTGTGAATTTGGGAGAGG No data
1053750679_1053750690 27 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750679_1053750689 24 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750689 9:41251409-41251431 GAGAGGGAGAGCACAGTGACTGG No data
1053750679_1053750685 2 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750685 9:41251387-41251409 ACACAGAAACCTGTGAATTTGGG No data
1053750679_1053750684 1 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750684 9:41251386-41251408 CACACAGAAACCTGTGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053750679 Original CRISPR TGTGTGGCTGCTGCTAGGTG GGG (reversed) Intergenic