ID: 1053750683

View in Genome Browser
Species Human (GRCh38)
Location 9:41251378-41251400
Sequence ACAGGTTTCTGTGTGTTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053750683_1053750687 -8 Left 1053750683 9:41251378-41251400 CCACACAACACACAGAAACCTGT No data
Right 1053750687 9:41251393-41251415 AAACCTGTGAATTTGGGAGAGGG No data
1053750683_1053750690 11 Left 1053750683 9:41251378-41251400 CCACACAACACACAGAAACCTGT No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750683_1053750689 8 Left 1053750683 9:41251378-41251400 CCACACAACACACAGAAACCTGT No data
Right 1053750689 9:41251409-41251431 GAGAGGGAGAGCACAGTGACTGG No data
1053750683_1053750686 -9 Left 1053750683 9:41251378-41251400 CCACACAACACACAGAAACCTGT No data
Right 1053750686 9:41251392-41251414 GAAACCTGTGAATTTGGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053750683 Original CRISPR ACAGGTTTCTGTGTGTTGTG TGG (reversed) Intergenic