ID: 1053750688

View in Genome Browser
Species Human (GRCh38)
Location 9:41251396-41251418
Sequence TCTCCCTCTCCCAAATTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053750688_1053750689 -10 Left 1053750688 9:41251396-41251418 CCTGTGAATTTGGGAGAGGGAGA No data
Right 1053750689 9:41251409-41251431 GAGAGGGAGAGCACAGTGACTGG No data
1053750688_1053750690 -7 Left 1053750688 9:41251396-41251418 CCTGTGAATTTGGGAGAGGGAGA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053750688 Original CRISPR TCTCCCTCTCCCAAATTCAC AGG (reversed) Intergenic