ID: 1053750690

View in Genome Browser
Species Human (GRCh38)
Location 9:41251412-41251434
Sequence AGGGAGAGCACAGTGACTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053750682_1053750690 22 Left 1053750682 9:41251367-41251389 CCTAGCAGCAGCCACACAACACA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750679_1053750690 27 Left 1053750679 9:41251362-41251384 CCCCACCTAGCAGCAGCCACACA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750677_1053750690 29 Left 1053750677 9:41251360-41251382 CCCCCCACCTAGCAGCAGCCACA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750681_1053750690 25 Left 1053750681 9:41251364-41251386 CCACCTAGCAGCAGCCACACAAC No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750683_1053750690 11 Left 1053750683 9:41251378-41251400 CCACACAACACACAGAAACCTGT No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750688_1053750690 -7 Left 1053750688 9:41251396-41251418 CCTGTGAATTTGGGAGAGGGAGA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750680_1053750690 26 Left 1053750680 9:41251363-41251385 CCCACCTAGCAGCAGCCACACAA No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data
1053750678_1053750690 28 Left 1053750678 9:41251361-41251383 CCCCCACCTAGCAGCAGCCACAC No data
Right 1053750690 9:41251412-41251434 AGGGAGAGCACAGTGACTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053750690 Original CRISPR AGGGAGAGCACAGTGACTGG AGG Intergenic