ID: 1053752814

View in Genome Browser
Species Human (GRCh38)
Location 9:41273633-41273655
Sequence GGCCCTCAGGCTGGGCGCGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752814_1053752831 23 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752831 9:41273679-41273701 TCCTCCACCTGAGGGAGATCGGG No data
1053752814_1053752825 14 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752814_1053752830 22 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752830 9:41273678-41273700 GTCCTCCACCTGAGGGAGATCGG No data
1053752814_1053752833 24 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752814_1053752827 15 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752827 9:41273671-41273693 CCGCCCAGTCCTCCACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752814 Original CRISPR GGCCCTCAGGCTGGGCGCGC TGG (reversed) Intergenic