ID: 1053752816

View in Genome Browser
Species Human (GRCh38)
Location 9:41273641-41273663
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752816_1053752837 28 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752816_1053752827 7 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752827 9:41273671-41273693 CCGCCCAGTCCTCCACCTGAGGG No data
1053752816_1053752836 23 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG No data
1053752816_1053752831 15 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752831 9:41273679-41273701 TCCTCCACCTGAGGGAGATCGGG No data
1053752816_1053752825 6 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752816_1053752833 16 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752816_1053752838 29 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752838 9:41273693-41273715 GAGATCGGGGCCGTTGGTATGGG No data
1053752816_1053752830 14 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752830 9:41273678-41273700 GTCCTCCACCTGAGGGAGATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752816 Original CRISPR AGCCTGGGGGCCCTCAGGCT GGG (reversed) Intergenic
No off target data available for this crispr