ID: 1053752818

View in Genome Browser
Species Human (GRCh38)
Location 9:41273646-41273668
Sequence GGCACAGCCTGGGGGCCCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752818_1053752837 23 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752818_1053752831 10 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752831 9:41273679-41273701 TCCTCCACCTGAGGGAGATCGGG No data
1053752818_1053752833 11 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752818_1053752836 18 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG No data
1053752818_1053752830 9 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752830 9:41273678-41273700 GTCCTCCACCTGAGGGAGATCGG No data
1053752818_1053752825 1 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752818_1053752838 24 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752838 9:41273693-41273715 GAGATCGGGGCCGTTGGTATGGG No data
1053752818_1053752827 2 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752827 9:41273671-41273693 CCGCCCAGTCCTCCACCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752818 Original CRISPR GGCACAGCCTGGGGGCCCTC AGG (reversed) Intergenic