ID: 1053752822

View in Genome Browser
Species Human (GRCh38)
Location 9:41273657-41273679
Sequence ACTGGGCGGGAGGCACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752822_1053752837 12 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752822_1053752825 -10 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752822_1053752831 -1 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752831 9:41273679-41273701 TCCTCCACCTGAGGGAGATCGGG No data
1053752822_1053752830 -2 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752830 9:41273678-41273700 GTCCTCCACCTGAGGGAGATCGG No data
1053752822_1053752827 -9 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752827 9:41273671-41273693 CCGCCCAGTCCTCCACCTGAGGG No data
1053752822_1053752838 13 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752838 9:41273693-41273715 GAGATCGGGGCCGTTGGTATGGG No data
1053752822_1053752833 0 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752822_1053752836 7 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752822 Original CRISPR ACTGGGCGGGAGGCACAGCC TGG (reversed) Intergenic