ID: 1053752823

View in Genome Browser
Species Human (GRCh38)
Location 9:41273667-41273689
Sequence CAGGTGGAGGACTGGGCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752823_1053752841 26 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752841 9:41273716-41273738 CCCTCAGCAGTCACCCCGTGTGG No data
1053752823_1053752836 -3 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG No data
1053752823_1053752844 28 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752844 9:41273718-41273740 CTCAGCAGTCACCCCGTGTGGGG No data
1053752823_1053752843 27 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752843 9:41273717-41273739 CCTCAGCAGTCACCCCGTGTGGG No data
1053752823_1053752838 3 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752838 9:41273693-41273715 GAGATCGGGGCCGTTGGTATGGG No data
1053752823_1053752837 2 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752823_1053752833 -10 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752823 Original CRISPR CAGGTGGAGGACTGGGCGGG AGG (reversed) Intergenic