ID: 1053752824

View in Genome Browser
Species Human (GRCh38)
Location 9:41273670-41273692
Sequence CCTCAGGTGGAGGACTGGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752824_1053752837 -1 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752824_1053752844 25 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752844 9:41273718-41273740 CTCAGCAGTCACCCCGTGTGGGG No data
1053752824_1053752841 23 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752841 9:41273716-41273738 CCCTCAGCAGTCACCCCGTGTGG No data
1053752824_1053752838 0 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752838 9:41273693-41273715 GAGATCGGGGCCGTTGGTATGGG No data
1053752824_1053752836 -6 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752836 9:41273687-41273709 CTGAGGGAGATCGGGGCCGTTGG No data
1053752824_1053752843 24 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752843 9:41273717-41273739 CCTCAGCAGTCACCCCGTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752824 Original CRISPR CCTCAGGTGGAGGACTGGGC GGG (reversed) Intergenic
No off target data available for this crispr