ID: 1053752825

View in Genome Browser
Species Human (GRCh38)
Location 9:41273670-41273692
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752816_1053752825 6 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752817_1053752825 5 Left 1053752817 9:41273642-41273664 CCAGCCTGAGGGCCCCCAGGCTG No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752811_1053752825 25 Left 1053752811 9:41273622-41273644 CCTCGGGATCGCCAGCGCGCCCA No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752821_1053752825 -9 Left 1053752821 9:41273656-41273678 CCCAGGCTGTGCCTCCCGCCCAG No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752818_1053752825 1 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752820_1053752825 -8 Left 1053752820 9:41273655-41273677 CCCCAGGCTGTGCCTCCCGCCCA No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752814_1053752825 14 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC 0: 14
1: 8
2: 7
3: 80
4: 721
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752819_1053752825 -7 Left 1053752819 9:41273654-41273676 CCCCCAGGCTGTGCCTCCCGCCC No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
1053752822_1053752825 -10 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752825 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752825 Original CRISPR CCCGCCCAGTCCTCCACCTG AGG Intergenic