ID: 1053752833

View in Genome Browser
Species Human (GRCh38)
Location 9:41273680-41273702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752818_1053752833 11 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752820_1053752833 2 Left 1053752820 9:41273655-41273677 CCCCAGGCTGTGCCTCCCGCCCA No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752823_1053752833 -10 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752814_1053752833 24 Left 1053752814 9:41273633-41273655 CCAGCGCGCCCAGCCTGAGGGCC No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752817_1053752833 15 Left 1053752817 9:41273642-41273664 CCAGCCTGAGGGCCCCCAGGCTG No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752821_1053752833 1 Left 1053752821 9:41273656-41273678 CCCAGGCTGTGCCTCCCGCCCAG No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752816_1053752833 16 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752819_1053752833 3 Left 1053752819 9:41273654-41273676 CCCCCAGGCTGTGCCTCCCGCCC No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data
1053752822_1053752833 0 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752833 9:41273680-41273702 CCTCCACCTGAGGGAGATCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752833 Original CRISPR CCTCCACCTGAGGGAGATCG GGG Intergenic