ID: 1053752837

View in Genome Browser
Species Human (GRCh38)
Location 9:41273692-41273714
Sequence GGAGATCGGGGCCGTTGGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053752819_1053752837 15 Left 1053752819 9:41273654-41273676 CCCCCAGGCTGTGCCTCCCGCCC No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752822_1053752837 12 Left 1053752822 9:41273657-41273679 CCAGGCTGTGCCTCCCGCCCAGT No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752816_1053752837 28 Left 1053752816 9:41273641-41273663 CCCAGCCTGAGGGCCCCCAGGCT No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752828_1053752837 -5 Left 1053752828 9:41273674-41273696 CCCAGTCCTCCACCTGAGGGAGA No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752821_1053752837 13 Left 1053752821 9:41273656-41273678 CCCAGGCTGTGCCTCCCGCCCAG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752829_1053752837 -6 Left 1053752829 9:41273675-41273697 CCAGTCCTCCACCTGAGGGAGAT No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752818_1053752837 23 Left 1053752818 9:41273646-41273668 CCTGAGGGCCCCCAGGCTGTGCC No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752823_1053752837 2 Left 1053752823 9:41273667-41273689 CCTCCCGCCCAGTCCTCCACCTG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752826_1053752837 -2 Left 1053752826 9:41273671-41273693 CCGCCCAGTCCTCCACCTGAGGG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752824_1053752837 -1 Left 1053752824 9:41273670-41273692 CCCGCCCAGTCCTCCACCTGAGG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752817_1053752837 27 Left 1053752817 9:41273642-41273664 CCAGCCTGAGGGCCCCCAGGCTG No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data
1053752820_1053752837 14 Left 1053752820 9:41273655-41273677 CCCCAGGCTGTGCCTCCCGCCCA No data
Right 1053752837 9:41273692-41273714 GGAGATCGGGGCCGTTGGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053752837 Original CRISPR GGAGATCGGGGCCGTTGGTA TGG Intergenic