ID: 1053753767

View in Genome Browser
Species Human (GRCh38)
Location 9:41281115-41281137
Sequence CTCTGGACAAGTGCTGGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053753767_1053753775 11 Left 1053753767 9:41281115-41281137 CCCTTCCCAGCACTTGTCCAGAG No data
Right 1053753775 9:41281149-41281171 CTCAGCACAGCTCAGACCTCAGG 0: 1
1: 3
2: 3
3: 33
4: 293

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053753767 Original CRISPR CTCTGGACAAGTGCTGGGAA GGG (reversed) Intergenic
No off target data available for this crispr