ID: 1053762712

View in Genome Browser
Species Human (GRCh38)
Location 9:41357278-41357300
Sequence CAGTCCCTGCACTGGGACCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053762712_1053762720 3 Left 1053762712 9:41357278-41357300 CCCGGGTCCCAGTGCAGGGACTG No data
Right 1053762720 9:41357304-41357326 GGAAGACACTTTCGTCCGTGGGG No data
1053762712_1053762721 10 Left 1053762712 9:41357278-41357300 CCCGGGTCCCAGTGCAGGGACTG No data
Right 1053762721 9:41357311-41357333 ACTTTCGTCCGTGGGGAATCAGG No data
1053762712_1053762718 1 Left 1053762712 9:41357278-41357300 CCCGGGTCCCAGTGCAGGGACTG No data
Right 1053762718 9:41357302-41357324 TGGGAAGACACTTTCGTCCGTGG No data
1053762712_1053762723 26 Left 1053762712 9:41357278-41357300 CCCGGGTCCCAGTGCAGGGACTG No data
Right 1053762723 9:41357327-41357349 AATCAGGCCGCGCTTCTCTGCGG No data
1053762712_1053762719 2 Left 1053762712 9:41357278-41357300 CCCGGGTCCCAGTGCAGGGACTG No data
Right 1053762719 9:41357303-41357325 GGGAAGACACTTTCGTCCGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053762712 Original CRISPR CAGTCCCTGCACTGGGACCC GGG (reversed) Intergenic
No off target data available for this crispr