ID: 1053762817

View in Genome Browser
Species Human (GRCh38)
Location 9:41357786-41357808
Sequence GAGTTGAATTTGAAGTTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053762817_1053762826 13 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762826 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data
1053762817_1053762822 0 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762817_1053762823 1 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762823 9:41357810-41357832 TGGGCCTTCTGTCCGAGTTGGGG No data
1053762817_1053762821 -1 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762821 9:41357808-41357830 CATGGGCCTTCTGTCCGAGTTGG No data
1053762817_1053762830 30 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762830 9:41357839-41357861 TAGTGGCCCGACGCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053762817 Original CRISPR GAGTTGAATTTGAAGTTTGT GGG (reversed) Intergenic
No off target data available for this crispr