ID: 1053762822

View in Genome Browser
Species Human (GRCh38)
Location 9:41357809-41357831
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053762813_1053762822 21 Left 1053762813 9:41357765-41357787 CCCTGGTGCCTCACCTCTATTCC No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762818_1053762822 -1 Left 1053762818 9:41357787-41357809 CCACAAACTTCAAATTCAACTCA No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762816_1053762822 8 Left 1053762816 9:41357778-41357800 CCTCTATTCCCACAAACTTCAAA No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762812_1053762822 22 Left 1053762812 9:41357764-41357786 CCCCTGGTGCCTCACCTCTATTC No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762817_1053762822 0 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762814_1053762822 20 Left 1053762814 9:41357766-41357788 CCTGGTGCCTCACCTCTATTCCC No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data
1053762815_1053762822 13 Left 1053762815 9:41357773-41357795 CCTCACCTCTATTCCCACAAACT No data
Right 1053762822 9:41357809-41357831 ATGGGCCTTCTGTCCGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053762822 Original CRISPR ATGGGCCTTCTGTCCGAGTT GGG Intergenic
No off target data available for this crispr