ID: 1053762826

View in Genome Browser
Species Human (GRCh38)
Location 9:41357822-41357844
Sequence CCGAGTTGGGGTACCCCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053762817_1053762826 13 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762826 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data
1053762815_1053762826 26 Left 1053762815 9:41357773-41357795 CCTCACCTCTATTCCCACAAACT No data
Right 1053762826 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data
1053762816_1053762826 21 Left 1053762816 9:41357778-41357800 CCTCTATTCCCACAAACTTCAAA No data
Right 1053762826 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data
1053762818_1053762826 12 Left 1053762818 9:41357787-41357809 CCACAAACTTCAAATTCAACTCA No data
Right 1053762826 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053762826 Original CRISPR CCGAGTTGGGGTACCCCTAG TGG Intergenic
No off target data available for this crispr