ID: 1053762830

View in Genome Browser
Species Human (GRCh38)
Location 9:41357839-41357861
Sequence TAGTGGCCCGACGCGCACCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053762824_1053762830 2 Left 1053762824 9:41357814-41357836 CCTTCTGTCCGAGTTGGGGTACC No data
Right 1053762830 9:41357839-41357861 TAGTGGCCCGACGCGCACCCTGG No data
1053762817_1053762830 30 Left 1053762817 9:41357786-41357808 CCCACAAACTTCAAATTCAACTC No data
Right 1053762830 9:41357839-41357861 TAGTGGCCCGACGCGCACCCTGG No data
1053762818_1053762830 29 Left 1053762818 9:41357787-41357809 CCACAAACTTCAAATTCAACTCA No data
Right 1053762830 9:41357839-41357861 TAGTGGCCCGACGCGCACCCTGG No data
1053762825_1053762830 -6 Left 1053762825 9:41357822-41357844 CCGAGTTGGGGTACCCCTAGTGG No data
Right 1053762830 9:41357839-41357861 TAGTGGCCCGACGCGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053762830 Original CRISPR TAGTGGCCCGACGCGCACCC TGG Intergenic
No off target data available for this crispr