ID: 1053764514

View in Genome Browser
Species Human (GRCh38)
Location 9:41377453-41377475
Sequence CAGGCACATGGTGTTGTTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053764514_1053764522 24 Left 1053764514 9:41377453-41377475 CCACCAACAACACCATGTGCCTG No data
Right 1053764522 9:41377500-41377522 AGCCCACAAAAGCAGCCAGAAGG No data
1053764514_1053764525 28 Left 1053764514 9:41377453-41377475 CCACCAACAACACCATGTGCCTG No data
Right 1053764525 9:41377504-41377526 CACAAAAGCAGCCAGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053764514 Original CRISPR CAGGCACATGGTGTTGTTGG TGG (reversed) Intergenic
No off target data available for this crispr