ID: 1053771936

View in Genome Browser
Species Human (GRCh38)
Location 9:41489418-41489440
Sequence TCTTATGTAAGATTAACTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053771936_1053771939 -8 Left 1053771936 9:41489418-41489440 CCATAAGTTAATCTTACATAAGA No data
Right 1053771939 9:41489433-41489455 ACATAAGAGGAAGAAGGCAATGG No data
1053771936_1053771941 11 Left 1053771936 9:41489418-41489440 CCATAAGTTAATCTTACATAAGA No data
Right 1053771941 9:41489452-41489474 ATGGCTAACAAAAGAAAAATGGG No data
1053771936_1053771940 10 Left 1053771936 9:41489418-41489440 CCATAAGTTAATCTTACATAAGA No data
Right 1053771940 9:41489451-41489473 AATGGCTAACAAAAGAAAAATGG No data
1053771936_1053771942 20 Left 1053771936 9:41489418-41489440 CCATAAGTTAATCTTACATAAGA No data
Right 1053771942 9:41489461-41489483 AAAAGAAAAATGGGCTTGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053771936 Original CRISPR TCTTATGTAAGATTAACTTA TGG (reversed) Intergenic
No off target data available for this crispr