ID: 1053773320

View in Genome Browser
Species Human (GRCh38)
Location 9:41505429-41505451
Sequence GCATGCAGGTGAGCAGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1053773320_1053773327 16 Left 1053773320 9:41505429-41505451 CCTGTACCTGCTCACCTGCATGC No data
Right 1053773327 9:41505468-41505490 TGGAACACAGCAGGTCAGAGTGG No data
1053773320_1053773328 17 Left 1053773320 9:41505429-41505451 CCTGTACCTGCTCACCTGCATGC No data
Right 1053773328 9:41505469-41505491 GGAACACAGCAGGTCAGAGTGGG No data
1053773320_1053773323 -7 Left 1053773320 9:41505429-41505451 CCTGTACCTGCTCACCTGCATGC No data
Right 1053773323 9:41505445-41505467 TGCATGCTCTCTCCTGCAAGAGG No data
1053773320_1053773324 -4 Left 1053773320 9:41505429-41505451 CCTGTACCTGCTCACCTGCATGC No data
Right 1053773324 9:41505448-41505470 ATGCTCTCTCCTGCAAGAGGTGG No data
1053773320_1053773326 7 Left 1053773320 9:41505429-41505451 CCTGTACCTGCTCACCTGCATGC No data
Right 1053773326 9:41505459-41505481 TGCAAGAGGTGGAACACAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1053773320 Original CRISPR GCATGCAGGTGAGCAGGTAC AGG (reversed) Intergenic
No off target data available for this crispr